Anacharis zealandica

Ashmead, 1900 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Figitidae/Anacharis

At a glance

Occurrence records696

Data sources5

Biological traits0

DNA specimens58

eDNA detections71

Sources5 archives

Databases and archives Anacharis zealandica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility696 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI71 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF696 records

Environmental DNA1 datasets · 2 countries71 detections

DNA & barcodingBOLD58 specimens

01Narrative

Anacharis zealandica, the lacewing parasitoid wasp, is a native New Zealand species, also present in southeastern Australia, that parasitises lacewings like Micromus tasmaniae and Drepanacra binocula.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacharis zealandica has left across the world's sequence archives.

At a glance

DNA specimens58

BINs1

Marker genes2

eDNA detections71

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

160Tmostly conserved

313Avariable

562Gmostly conserved

TCTATACTTTATTTTCGGAATATGATCAGGAATAATAGGATCAAGATTAAGTATAATTATTCGTATAGAACTAGGAACCCCCTCCCAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes6

BIN1

Most divergent pair2.0%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anacharis eucharioidessame genus14.4%Anacharis eucharoidessame genus14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type696 records

Wild obs. + sensor107

Museum / vouchered589

Origin

Native493

Introduced4

Range

Area of Occupancy AOO876 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 48≤1 km 10≤10 km 3>10 km 6

67 georeferenced · 40 without coordinates

Open the mapobservation + sensor107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 34≤1 km 162≤10 km 155>10 km 2

353 georeferenced · 236 without coordinates

Open the institutions mapphysical evidence589

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MWLRlocation not on record	501
Auckland, NZ	81

2 institutions · 582 of 589 vouchered records shown · 7 without an institution code

09Environmental DNA71 detections

Where the DNA of Anacharis zealandica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found71

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 71 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate ForestForestforest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 11.6–18.9

Seasonal swing summer↔winter9.60 °C

Max temp (day)17.4 °C 15.2–21.4

Min temp (night)10.6 °C 7.00–15.2

Precipitation96.3 mm/mo 50.4–114

Air humidity62.1 % 57.7–63.7

Moisture balance-31.1 mm/mo -82.1–-6.40

Vapour deficit594 Pa 503–874

Wind speed5.20 m/s 2.60–5.60

Cloud cover37.0 % 20.4–39.9

CHELSA 1981–2010, ~9 km grid, at location & month of 67 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)