Anacardium occidentale
speciesAt a glance
Occurrence records10 044
Data sources16
Biological traits57
DNA specimens20
eDNA detections16
Sources16 archives
Databases and archives Anacardium occidentale's data was compiled from.
WikipediaWikimedia Foundation21 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility10 044 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics20 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources57 traits
Chemical compositionFooDB · LOTUS · NPASS5 775 compounds
Occurrence & distributionGBIF10 044 records
Environmental DNA3 datasets · 6 countries16 detections
DNA & barcodingBOLD · NCBI20 specimens
Genome at a glanceCCDB · GoaT · NCBI≈357 Mbp
01Narrative
Anacardium othonianum is a tree native from the tropical savanna (cerrado) region of Brazil, whose fruit is similar to (but smaller than) that of the common cashew tree (A. occidentale) of the Brazilian Northeast. It is locally known by the Tupi-derived name cajuí, and by the Portuguese names caju-de-árvore-do-cerrado ("tree cashew of the cerrado"), caju-vermelho-de-goiás ("red cashew from Goiás"),Julio S. Inglez de Souza, Aristeu Mendes Peixoto, Francisco Ferraz de Toledo () Enciclopédia Agrícola Brasileira, volume 2, p.76 cajuzinho-do-cerrado or just cajuzinho ("little cashew").Tânia da Silveira Agostini-Costa, Juliana Pereira Faria, Ronaldo Veloso Naves, and Roberto Fontes Vieira (2006), Cajus do Cerrado. Chapter 8 of R. F. Vieira el al., eds. (2006) Futas Nativas da Região Centro-Oeste do Brasil. EMBRAPA. The species name honors Brazilian botanist Othon Xavier de Brito Machado.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology25
Fruit length22.5 mm
Fruit length max25 mm
Fruit length min20 mm
Fruit width15 mm
Fruit width max50 mm
Fruit width min15 mm
Inflorescence length max25 cm
Inflorescence length min10 cm
Leaf length max210 mm
Leaf length min100 mm
Leaf mass per area120 g/m2
Leaf size10 395 mm²
Leaf width max100 mm
Leaf width min50 mm
Plant height12 m
⚠ sources differ — GIFT: 12 m · TRY: 10 m
Plant height max12 m
Plant height min1 m
Seed length27.27 mm
Seed length max20 mm
Seed mass4 086 mg
Seed mass max4 673 mg
Seed mass min3 500 mg
Seed volume5 000 mm³
Seed volume max5 000 mm³
Seed volume min5 000 mm³
Life cycle & reproduction9
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal type detailedanthropochorous
Flower colourgreen
Life formtree
Life spanperennial
Pollination syndrome detailedant
Raunkiær life formphanerophyte
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 000 m
Elevation mean200 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typedrupe
Growth formtree
Habitat GIFTCaatinga (stricto sensu), Cerrado (lato sensu), Restinga, Savana Amazônica
Mycorrhiza typearbuscular
Succulenceno
Woodinesswoody
Physiology & chemistry8
Ldmc max385 mg/g
Ldmc min385 mg/g
Leaf dry-matter content (LDMC)429 mg/g
⚠ sources differ — TRY: 429 mg/g · GIFT: 385 mg/g
Leaf n13 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)8.3 mm²/mg
Wood density452 mg/cm³
03Chemical composition5 775 compounds
Compounds documented for Anacardium occidentale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingNuts
Compound class profile5 classes
Aminoacids194
Glycerophospholipids57
Catechols with side chains51
Branched fatty acids $ Unsaturated fatty acids47
Pyridine alkaloids44
Documented compounds5 775 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Elaidic acid | 28,204 mg/100g | FooDB | |
| α-D-galactose | 23,490 mg/100g | FooDB | |
| Chinese tannin | 9,000 mg/100g | FooDB | |
| (Z,Z)-9,12-Octadecadienoic acid | 8,900 mg/100g | FooDB |
05DNA & barcoding20 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacardium occidentale has left across the world's sequence archives.
At a glance
DNA specimens20
Marker genes9
GenBank sequences10
eDNA detections16
Countries6
The DNA barcodea real sequence read deposited for this species
CGCATCGTCGCCCTCCCCGGATCCTCCGGTTCCGCGGCGCTGGGCGGAAGGTGGCCTCCCGTGCGCTCGCCCGTGCGGTTGGCCCAAACG …
Anacardium occidentale internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL2★rbcLa★trnL-F★ITS8★ITS2psbK-psbIrpoBycf1
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Anacardium occidentale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size≈356 592 713 bp assembly estimate
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Anacardium occidentale0.36 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidypolyploid inferred
Chromosome records12–422n range42median42mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 425×CCDB · croinout · CCDB · book-indian_vol1 · CCDB · book-fedorov +1
CCDB · croinout — Darlington, C. D. & Janaki Ammal, E. K. 1945
CCDB · book-indian_vol1 — Janaki Ammal (D. 1945); Rai, R. 1979
CCDB · book-fedorov — Janaki Ammal
CCDB · book-fedorov — D. 1945)
CCDB · book-atlas-flowering-plants — EKJ*
2n 402×CCDB · ipcn-api-dl · CCDB · book-indian_vol1
CCDB · ipcn-api-dl — Pedrosa, A. 1999. Citogenética de angiospermas coletadas em Pernambuco - V. Acta Bot. Brasil. 13(1): 49–60.
CCDB · book-indian_vol1 — Gill, B. S. et al. 1979b
2n 121×CCDB · croinout
CCDB · croinout — Mulligan, G. A. & A. E. Porsild 1969
2n 241×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Mehra, P. N. & Khosla, P. K. 1969 ; Khosla, P. K. et a!. 1973
n 206×CCDB · croinout · CCDB · ipcn-api-dl
CCDB · croinout — Aparicio, A. & S. Silvestre. 1985
CCDB · croinout — Huber, W. & M. Baltisberger 1989
CCDB · croinout — Kiehn, M., E. Vitek, E. Hellmayr &al. 1991
CCDB · ipcn-api-dl — Singhal, V. K. & B. S. Gill. 1990. Chromosomal studies in some members of Anacardiaceae. J. Cytol. Genet. 25: 36–42.
CCDB · ipcn-api-dl — Gill, B. S., V. K. Singhal, Y. S. Bedi & S. S. Bir. 1990. Cytological evolution in the woody taxa of Pachmarhi Hills. J. Cytol. Genet. 25: 308–320.
CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir & V. K. Singhal. 1979a. In IOPB chromosome number reports LXV. Taxon 28:630.
n 125×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · croinout — Stoeva, M. P. 1987
CCDB · croinout — Xu, B.-s., R.-f. Weng & M.-z. Zhang 1992
CCDB · ipcn-api-dl — Sandhu, P. S. & S. K. Mann. 1988. SOCGI plant chromosome number reports -- VII. J. Cytol. Genet. 23: 219–228.
CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.
CCDB · book-ipcn67-71 — MEHRA, P.N., & P.K. KHOSLA. 1969. In IOPB chromosome number reports XX. Taxon 18: 213-221.
n 212×CCDB · croinout · CCDB · ipcn-api-dl
CCDB · croinout — Baltisberger, M. 1991
CCDB · ipcn-api-dl — Rai, R. 1979. Cytological studies in cashew (Anacardium occidentale L.). Proc. Indian Sci. Congr. Assoc. (III, C) 66: 84.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
08Occurrence & distribution
Record type10 044 records
Wild obs. + sensor5 713
Museum / vouchered4 242
Cultivated / captive10
Other79
Origin
Native1 350
Introduced41
Range
Area of Occupancy AOO22 944 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy89% within 1 km
≤100 m 2 203≤1 km 408≤10 km 241>10 km 97
2 949 georeferenced · 2 764 without coordinates
Open the mapobservation + sensor5 713
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy58% within 1 km
≤100 m 102≤1 km 74≤10 km 65>10 km 63
304 georeferenced · 3 938 without coordinates
Open the institutions mapphysical evidence4 242
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 10 records without
Open the mapnot free-living10
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions106 of 271 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 446 |
| Saint Louis, US | 247 |
| Cenargenlocation not on record | 140 |
| Université de Bordeauxlocation not on record | 137 |
| Brasília, BR | 131 |
| University of Stellenboschlocation not on record | 103 |
| Masindi, UG | 94 |
| Laboratorio de Ictiologialocation not on record | 87 |
| Chicago, US | 82 |
| UnBlocation not on record | 78 |
| UFBAlocation not on record | 78 |
| JBRJlocation not on record | 77 |
| USP-IBlocation not on record | 75 |
| Universidade Federal de Sergipe (UFS)location not on record | 70 |
| Departamento de Sistematica e Ecologialocation not on record | 66 |
| Chaguaramas, TT | 61 |
| UNIVASFlocation not on record | 59 |
| National Biodiversity Institute, Costa Ricalocation not on record | 57 |
| Kew, GB | 57 |
| UNICAMPlocation not on record | 51 |
| Universidade Federal do Maranhãolocation not on record | 46 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 45 |
| UNESP-FCAlocation not on record | 41 |
| Instituto do Meio Ambientelocation not on record | 39 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 38 |
| Museu Paraense Emílio Goeldilocation not on record | 38 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 37 |
| Brasília, BR | 37 |
| Baroda, IN | 31 |
| Durango, MX | 31 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 30 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 29 |
| UFRPElocation not on record | 27 |
| Feira de Santana, BR | 27 |
| UEMAlocation not on record | 26 |
| Universidade Federal do Vale do São Franciscolocation not on record | 26 |
| Salvador, BR | 26 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 25 |
| UEPAlocation not on record | 24 |
| Leiden University Medical Centerlocation not on record | 24 |
| UNITINSlocation not on record | 23 |
| Mexico City, MX | 22 |
| Universidad Nacional de Colombia (UNAL)location not on record | 22 |
| Mexico City, MX | 21 |
| Fortaleza, BR | 21 |
| CEPLAClocation not on record | 20 |
| IECOSlocation not on record | 20 |
| Ilhéus, BR | 20 |
| URCAlocation not on record | 20 |
| Teresina, BR | 19 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 17 |
| Universidad de Antioquia (UdeA)location not on record | 17 |
| Museum of Zoologylocation not on record | 16 |
| MeiseBGlocation not on record | 15 |
| Altos de Pipe, VE | 15 |
| Bogotá, D.C., CO | 15 |
| UFESlocation not on record | 15 |
| Guatemala, GT | 15 |
| UFVJMlocation not on record | 15 |
| UNEMATlocation not on record | 15 |
| Paris, FR | 15 |
| Universidade Federal de Goiáslocation not on record | 14 |
| Istituto Agrario Castelnuovolocation not on record | 13 |
| Brisbane, AU | 12 |
| Universidade do Estado de Mato Grossolocation not on record | 12 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 12 |
| CPATSAlocation not on record | 12 |
| Tampa, US | 11 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 11 |
| HUENFlocation not on record | 11 |
| HNBlocation not on record | 11 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 10 |
| UFMGlocation not on record | 10 |
| Cuiabá, BR | 10 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 10 |
| Pondicherry, IN | 9 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 9 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 9 |
| Campo Grande, BR | 9 |
| IFAN Ch. A. Dioplocation not on record | 9 |
| Smithfield, AU | 8 |
| Maringá, BR | 8 |
| INMAlocation not on record | 8 |
| Palmerston, AU | 8 |
| Universidade Federal de Juiz de Foralocation not on record | 8 |
| León, NI | 7 |
| UESBlocation not on record | 7 |
| Herbier National du Gabonlocation not on record | 7 |
| LDlocation not on record | 7 |
| UFRRJlocation not on record | 7 |
| Durham, US | 7 |
| LSF/FSA/UAClocation not on record | 7 |
| San José, CR | 7 |
| UFMSlocation not on record | 7 |
| UEMlocation not on record | 6 |
| Federal University of Espírito Santolocation not on record | 6 |
| UFERSAlocation not on record | 6 |
| Uberlândia, BR | 6 |
| Ivano-Frankivsk, UA | 6 |
| Fort Worth, US | 6 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 6 |
| Honolulu, US | 6 |
| LSFlocation not on record | 6 |
| Mérida, MX | 6 |
| Universidade Federal do Espírito Santolocation not on record | 6 |
| Frankfurt am Main | 6 |
| CNF-UFHBlocation not on record | 6 |
| Beijing, CN | 5 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 5 |
| IPA/SPlocation not on record | 5 |
| Porto Alegre, BR | 5 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 5 |
| Santa Teresa, BR | 5 |
| Campo Mourão, BR | 5 |
| Riverside, US | 5 |
| UTFPR-CPlocation not on record | 5 |
| Mexico City, MX | 5 |
| Santarém, BR | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| Chongqing Museumlocation not on record | 5 |
| Universidade Federal do Oeste da Bahialocation not on record | 5 |
| FUNEDlocation not on record | 5 |
| San Francisco, US | 4 |
| Université de Strasbourglocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Provincia di Livornolocation not on record | 4 |
| Ural Federal University "B. N. Yeltsin"location not on record | 4 |
| University of Papua New Guinealocation not on record | 4 |
| UNESP-RClocation not on record | 4 |
| Philadelphia, US | 4 |
| Canberra, AU | 4 |
| Durban, ZA | 4 |
| Barcelona, ES | 4 |
| Cruz das Almas, BR | 4 |
| Jataí / Setor Industrial, BR | 4 |
| Berlin, DE | 4 |
| Yaoundé, CM | 4 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 4 |
| Blumenau, BR | 4 |
| Universiti Sains Malaysialocation not on record | 4 |
| BISHlocation not on record | 4 |
| Foz do Iguaçu, BR | 4 |
| MEXUlocation not on record | 4 |
| Johnson City, US | 3 |
| Seychelles National Herbariumlocation not on record | 3 |
| UNESClocation not on record | 3 |
| Université du Lomélocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Xiamen, CN | 3 |
| Wuzhou, CN | 3 |
| TAFORI-LSRClocation not on record | 3 |
| Wlocation not on record | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| Santa Cruz de la Sierra, BO | 3 |
| Antiguo Cuscatlán, SV | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Kunming, CN | 3 |
| HUT Culture Collectionlocation not on record | 3 |
| INBIOlocation not on record | 3 |
| COLlocation not on record | 3 |
| Moscow State Universitylocation not on record | 3 |
| UNIVILLElocation not on record | 3 |
| Sri Ramaswamy Memorial Universitylocation not on record | 3 |
| Universidad del Quindío (UniQuindío)location not on record | 3 |
| Tapachula, MX | 3 |
| Universidade Federal de Santa Catarinalocation not on record | 3 |
| Auckland, NZ | 3 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 3 |
| Guangzhou, CN | 3 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 3 |
| PUC-RSlocation not on record | 2 |
| LBVlocation not on record | 2 |
| UFSClocation not on record | 2 |
| Plocation not on record | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Edinburgh, GB | 2 |
| HACAMlocation not on record | 2 |
| Anton de Kom University of Surinamelocation not on record | 2 |
| ASUlocation not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| Universidade Paulistalocation not on record | 2 |
| HUAlocation not on record | 2 |
| EL PASO, US | 2 |
| Guatemala City, GT | 2 |
| UNESP-IBILCElocation not on record | 2 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 2 |
| Chapingo, MX | 2 |
| Cusco, PE | 2 |
| ESALQlocation not on record | 2 |
| UFPElocation not on record | 2 |
| MAlocation not on record | 2 |
| Pretoria, ZA | 2 |
| Dekalb, US | 2 |
| Porto Velho, BR | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Miami, US | 2 |
| San Francisco de Campeche, MX | 2 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 2 |
| Calabar, NG | 2 |
| Madison, US | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| OTSlocation not on record | 1 |
| Lima, PE | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| BMlocation not on record | 1 |
| Armidale, AU | 1 |
| Stockholm, SE | 1 |
| Puerto Ayora, EC | 1 |
| Mérida, MX | 1 |
| Hobart, AU | 1 |
| James Cook Townsvillelocation not on record | 1 |
| MEDELlocation not on record | 1 |
| Glocation not on record | 1 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 1 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 1 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 1 |
| Panjab Universitylocation not on record | 1 |
| LGlocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| UFOPlocation not on record | 1 |
| Uppsala, SE | 1 |
| MSB-3349location not on record | 1 |
| Universidade da Região de Joinville - Univillelocation not on record | 1 |
| Loja, EC | 1 |
| Yangling, CN | 1 |
| Claremont, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Iquitos, PE | 1 |
| National Museums of Kenyalocation not on record | 1 |
| UFPRlocation not on record | 1 |
| GB | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Görlitz, DE | 1 |
| Ojo, NG | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| UFPIlocation not on record | 1 |
| UFABClocation not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| Kensington, AU | 1 |
| UTFPR-SLlocation not on record | 1 |
| CMULlocation not on record | 1 |
| University of Calabar/Department of Plant and Ecological Studies Herbariumlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Bloomington, US | 1 |
| Gump Stationlocation not on record | 1 |
| South Kensington, GB | 1 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| Seropédica, BR | 1 |
| UNISANTAlocation not on record | 1 |
| Criciúma, BR | 1 |
| Herbario MAT de la Universidad Politécnica Estatal del Carchilocation not on record | 1 |
| University of Johannesburglocation not on record | 1 |
| Mexico City, MX | 1 |
| Bangkok, TH | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| MUFALlocation not on record | 1 |
| Montpellier, FR | 1 |
| Minia, EG | 1 |
| Vancouver, CA | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| Corrientes, AR | 1 |
| UNESP-FCAVlocation not on record | 1 |
| St. Augustine, TT | 1 |
| UTFPR-DVlocation not on record | 1 |
| UERJlocation not on record | 1 |
271 institutions · 3 982 of 4 242 vouchered records shown · 259 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Anacardium occidentale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys3
Countries6
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
pH5.80 5.25–7.08
Conductivity24.5 µS/cm 22.4–88,800
Organic carbon0.39 % 0.26–6.44
Water content5.41 % 5.37–5.45
Phosphorus360 mg/kg 335–385
Clay20.8 %
Sand68.1 % 49.7–69.9
Depth0 m 0–3.00
SoilSedimentLatLon out of rangeSodosolVertosol
6 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.0 °C 1.30–25.1
Seasonal swing summer↔winter11.9 °C
Max temp (day)25.2 °C 3.10–30.5
Min temp (night)15.7 °C -1.00–20.1
Precipitation67.8 mm/mo 16.7–109
Air humidity55.5 % 48.5–60.9
Moisture balance-17.8 mm/mo
Vapour deficit1,103 Pa 307–1,616
Wind speed2.70 m/s
Cloud cover25.2 % 14.9–53.0
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.