Anacampsis levipedella

(Clemens, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records239

Data sources8

Biological traits0

DNA specimens5

eDNA detections6

Sources8 archives

Databases and archives Anacampsis levipedella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility239 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF239 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD5 specimens

01Narrative

Anacampsis levipedella is a moth of the family Gelechiidae. It was described by James Brackenridge Clemens in 1863. It is found in North America, where it has been recorded from Alabama, Florida, Georgia, Illinois, Indiana, Iowa, Kentucky, Maryland, Massachusetts, Mississippi, New Jersey, New York, North Carolina, Ohio, Oklahoma, Tennessee, Texas, Virginia, West Virginia and Wisconsin.Moth Photographers Group. Mississippi State University. The forewings are dark brownish, with a cupreous line. The apical half of the wing is darker than the basal half. About the middle of the costa is a short, oblique white streak and another of the same hue midway between it and the tip of the wing, perpendicular to the costa and of nearly triangular form. Beneath the first costal streak are two short, longitudinal dashes, one on each side of the fold of the wing, and two others of the same hue, parallel, and beneath the second costal streak. The hindwings are dark brownish.Proceedings of the Entomological Society of Philadelphia 2: 4

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis levipedella has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

49Tvariable

81Amostly conserved

106Cvariable

235Tvariable

433Amostly conserved

619Cvariable

AACTTTATATTTTATCTTCGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAGCCGAATTAGGTAACCCAGGTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.49%

Haplotypes4

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cnaphalocrocis poeyalissame order9.7%Miaromima naessigisame order9.7%Pycnarmon lactiferalissame order9.9%Dichogama prognealissame order9.9%Herpetogramma phaeopteralissame order10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type239 records

Wild obs. + sensor226

Museum / vouchered13

Range

Area of Occupancy AOO792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 117≤1 km 30≤10 km 13>10 km 31

191 georeferenced · 35 without coordinates

Open the mapobservation + sensor226

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 4>10 km 2

7 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	4
Philadelphia, US	3
King Saud Universitylocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Champaign, US	1
Cornell University Insect Collectionlocation not on record	1
St. Paul, US	1
Georgia Museum of Natural Historylocation not on record	1

8 institutions · 13 of 13 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Anacampsis levipedella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 14.5–22.7

Seasonal swing summer↔winter20.4 °C

Max temp (day)24.9 °C 19.1–27.8

Min temp (night)14.6 °C 10.0–17.6

Precipitation110 mm/mo 84.0–136

Air humidity57.4 % 56.8–59.7

Moisture balance-35.1 mm/mo -66.6–9.50

Vapour deficit944 Pa 689–1,160

Wind speed2.20 m/s 1.90–3.60

Cloud cover38.8 % 34.5–40.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)