Anacampsis hirsutella — The Life Data

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anacampsis

At a glance

Occurrence records3

Data sources7

Biological traits0

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Anacampsis hirsutella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 records

DNA & barcodingBOLD3 specimens

01Narrative

Anacampsis hirsutella is a moth of the family Gelechiidae. It is found in Austria, Switzerland, France and Italy.Fauna Europaea The wingspan is about 14 mm.lepiforum.de

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anacampsis hirsutella has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 530 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes2

BIN1

Most divergent pair0.13%

Where individuals differ — all 2 variable positions, in barcode order

594Gvariable

1269Cvariable

CGAAAATGACTTTTCTCAACAAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGCATTTGAGCAGGAATAGTTGGTACATCTTTA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type3 records

Museum / vouchered1

Other2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the institutions mapphysical evidence1

10Collections & institutions

Institution	Specimens
Cornell University Insect Collectionlocation not on record	1

1 institutions · 1 of 1 vouchered records shown