Anabolia bimaculata

(Walker, 1852) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Limnephilidae/Anabolia

At a glance

Occurrence records872

Data sources5

Biological traits0

DNA specimens209

eDNA detections210

Sources5 archives

Databases and archives Anabolia bimaculata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility872 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI210 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics209 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF872 records

Environmental DNA1 datasets · 2 countries210 detections

DNA & barcodingBOLD209 specimens

01Narrative

Anabolia bimaculata is een schietmot uit de familie Limnephilidae. De soort komt voor in het Nearctisch gebied.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding209 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anabolia bimaculata has left across the world's sequence archives.

At a glance

DNA specimens209

BINs1

Marker genes4

eDNA detections210

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus193 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

23Amostly conserved

184Amostly conserved

325Amostly conserved

346Tmostly conserved

379Amostly conserved

496Tmostly conserved

AACTATTTATTTTATCTTTGGAATTTGAGCAGGAATAATTGGAACTTCTCTTAGAATAATTATTCGAACTGAACTCGGAACTACTGAATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes19

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anabolia consociasame genus9.7%Limnephilus flavospinosussame family11.9%Limnephilus secludenssame family11.9%Anabolia brevipennissame genus11.9%Phanocelia canadensissame family12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCADHEF1-alphaRPB2

animal barcodemarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_036004 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type872 records

Museum / vouchered872

Range

Area of Occupancy AOO1 240 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 26≤1 km 55≤10 km 88>10 km 35

204 georeferenced · 668 without coordinates

Open the institutions mapphysical evidence872

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	207
Champaign, US	130
University of Guelph, Centre for Biodiversity Genomicslocation not on record	92
University of Alberta Museums (UAM)location not on record	86
Montréal, CA	48
Toronto, CA	43
Royal Saskatchewan Museumlocation not on record	40
Vancouver, CA	13
Colorado State Universitylocation not on record	13
Edmonton, CA	5
Centre for Biodiversity Genomicslocation not on record	4
Wuzhou, CN	2
Natural History Museum Rotterdamlocation not on record	2
WIlocation not on record	1
Saint John, CA	1
Chicago, US	1

16 institutions · 688 of 872 vouchered records shown · 184 without an institution code

09Environmental DNA210 detections

Where the DNA of Anabolia bimaculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found210

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 210 detections have coordinates

Open the map2 countries0

GrasslandMixed HabitatStreamMixed habitatForestSilver Creek

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.9 °C 10.2–16.2

Seasonal swing summer↔winter37.0 °C

Max temp (day)14.8 °C 14.2–23.2

Min temp (night)7.10 °C 6.90–12.4

Precipitation88.0 mm/mo 52.6–96.1

Air humidity61.6 % 52.6–62.6

Moisture balance-15.7 mm/mo -75.3–10.2

Vapour deficit489 Pa 466–882

Wind speed2.70 m/s 2.20–3.50

Cloud cover44.1 % 32.4–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 207 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)