Anablepsoides cearensis

(Costa & Vono, 2009) · species

image placeholder — illustration coming later

Animalia/Chordata/Cyprinodontiformes/Rivulidae/Anablepsoides

At a glance

Occurrence records0

Data sources7

Biological traits3

DNA specimens8

eDNA detections0

Sources7 archives

Databases and archives Anablepsoides cearensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

DNA & barcodingBOLD8 specimens

Genome at a glanceGoaT · NCBI≈771 Mbp

01Narrative

Anablepsoides cearensis is een straalvinnige vissensoort uit de familie van de killivisjes (Rivulidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 2009 door Costa & Vono.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anablepsoides cearensis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P465 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes2

BIN1

Most divergent pair0.22%

Where individuals differ — all 1 variable positions, in barcode order

219Gmostly conserved

GACCAAATCTATAACGTAATTGTAACAGCACACGCTTTTGTAATAATCTTTTTTATAGTTATACCAATTATAATTGGAGGCTTTGGTAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cynodonichthys birkhahnisame family11.6%Anablepsoides hartiisame genus13.1%Atlantirivulus ribeirensissame order13.1%Cynodonichthys myersisame family13.3%Atlantirivulus santensissame order14.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anablepsoides cearensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈771 123 444 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anablepsoides cearensis0.77 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)