Anableps anableps

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Chordata/Cyprinodontiformes/Anablepidae/Anableps

At a glance

Occurrence records668

Data sources12

Biological traits0

DNA specimens13

eDNA detections13

Sources12 archives

Databases and archives Anableps anableps's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility518 records↗

OBISOcean Biodiversity Information System150 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS668 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD13 specimens

Genome at a glanceGoaT · NCBI≈868 Mbp

01Narrative

Anableps anableps, the largescale four-eyes, is a species of four-eyed fish found in fresh and brackish waters of northern South America and Trinidad. This species grows to a length of 30 cm TL. This fish can occasionally be found in the aquarium trade. The fish does not actually have four eyes, but instead each eye is split into two lobes by a horizontal band of tissue, each lobe with its own pupil and separate vision. This allows the fish to see above and below the surface of the water at the same time.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anableps anableps has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P555 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

66Gmostly conserved

264Cmostly conserved

288Tmostly conserved

318Cmostly conserved

342Tmostly conserved

456Tmostly conserved

471Tmostly conserved

GACGACCAAATTTACAATGTAATCGTTACAGCTCATGCCTTTGTAATAATCTTTTTTATAGTTATGCCCATCATAATTGGAGGCTTTGGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.35%

Haplotypes3

BIN1

Most divergent pair1.1%

S.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Gadopsis marmoratussame order13.9%Pseudacanthicus serratussame order16.2%Poecilia veliferasame order16.4%Microgadus tomcodsame order16.8%Fundulus stellifersame order16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anableps anableps carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈867 616 482 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anableps anableps0.87 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness94.6% BUSCO

08Occurrence & distribution

Record type668 records

Wild obs. + sensor544

Museum / vouchered124

Origin

Native1

Range

Area of Occupancy AOO1 192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 102≤1 km 45≤10 km 81>10 km 32

260 georeferenced · 284 without coordinates

Open the mapobservation + sensor544

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 5≤1 km 1≤10 km 4>10 km 46

56 georeferenced · 68 without coordinates

Open the institutions mapphysical evidence124

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	20
Museu Paraense Emílio Goeldilocation not on record	6
Stockholm, SE	3
Museu de Zoologia da Universidade de Sao Paulolocation not on record	3
Paris, FR	3
Toronto, CA	3
SNSB-Zoologische Staatssammlung Münchenlocation not on record	3
UNICAMPlocation not on record	3
UFESlocation not on record	2
CASlocation not on record	2
Chicago, US	2
FishBaselocation not on record	1
Geneva, CH	1
INMAlocation not on record	1
Los Angeles, US	1
PUC-RSlocation not on record	1
	1
Champaign, US	1
Ann Arbor, US	1

19 institutions · 58 of 124 vouchered records shown · 3 without an institution code

09Environmental DNA13 detections

Where the DNA of Anableps anableps was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 21.6–28.2

Seasonal swing summer↔winter2.10 °C

Max temp (day)30.2 °C 25.2–33.0

Min temp (night)23.6 °C 17.6–25.0

Precipitation164 mm/mo 16.1–397

Air humidity64.0 % 59.5–68.1

Moisture balance32.9 mm/mo -157–264

Vapour deficit1,154 Pa 951–1,537

Wind speed2.60 m/s 1.30–2.60

Cloud cover41.8 % 17.2–44.8

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)