Anabathmis newtonii

(Bocage, 1887) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Nectariniidae/Anabathmis

At a glance

Occurrence records2 241

Data sources8

Biological traits24

DNA specimens3

eDNA detections0

Sources8 archives

Databases and archives Anabathmis newtonii's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 241 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF2 241 records

DNA & barcodingBOLD3 specimens

01Narrative

Chrysococcyx cupreus in a spawn of Anabathmis newtonii - MHNT Newton's sunbird, or the São Tomé sunbird (Anabathmis newtonii) is a species of bird in the family Nectariniidae. It is endemic to São Tomé Island. It is one of the smallest sunbirds. In general, the bird has dark olive upperparts - the male has an iridescent green-purple throat and upper breast region, while females have a dull olive throat and yellowish underparts, but underparts in female youth do not develop into yellow until later sexual maturity.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDBEltonTraitsAVONET

Size & morphology13

Beak depth2.5 mm

Beak length (culmen)16.7 mm

Beak length (nares)11.8 mm

Beak width3.2 mm

Body mass6.5 g

Body mass (female)6 g

Body mass (male)7 g

Hand-wing index19.4

Kipp's distance9.9 mm

Secondary length41.5 mm

Tail length38.4 mm

Tarsus length17.4 mm

Wing length51.8 mm

Life cycle & reproduction1

Egg mass0.91 g

Diet & foraging6

Canopy50 %

Invertebrate50 %

Midhigh50 %

Nectar50 %

Trophic levelomnivore

Trophic nicheOmnivore

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size859 km²

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anabathmis newtonii has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACCCTCTACCTAATCTTTGGCGCATGAGCCGGAATAGTGGGCACCGCTCTAAGCCTCCTAATTCGAGCAGAGCTTGGACAACCCGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cinnyris reichenowisame family6.8%Cyanomitra verticalissame family10.3%Cinnyris jugularissame family10.3%Hedydipna collarissame family11.0%Anabathmis reichenbachiisame genus11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 241 records

Wild obs. + sensor2 198

Museum / vouchered43

Origin

Native4

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 101≤1 km 27≤10 km 6>10 km 18

152 georeferenced · 2 046 without coordinates

Open the mapobservation + sensor2 198

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 43 records without

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Geneva, CH	30
Instituto de Investigação Científica Tropicallocation not on record	10

2 institutions · 40 of 43 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anabathmis newtonii

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction1

Diet & foraging6

Habitat & environment4

At a glance

Record type2 241 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 2 geolocated

Record type2 241 records