Anabathmis hartlaubii

(Hartlaub, 1857) · species

image placeholder — illustration coming later

Animalia/Chordata/Aves/Passeriformes/Nectariniidae/Anabathmis

At a glance

Occurrence records387

Data sources7

Biological traits22

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Anabathmis hartlaubii's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility387 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

IOC World Bird ListIOCbird checklist↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF387 records

DNA & barcodingBOLD3 specimens

01Narrative

The Príncipe sunbird (Anabathmis hartlaubii) is a species of bird in the family Nectariniidae. It is endemic to Príncipe island.BirdLife International, Species Factsheet Anabathmis hartlaubii, accessed 17 January 2019

No narrative description available for this taxon yet.

02Traits & measurements

SourcesEltonTraitsAVONETAmnioteDB

Size & morphology11

Beak depth3.3 mm

Beak length (culmen)22.7 mm

Beak length (nares)16.2 mm

Beak width3.1 mm

Body mass10.5 g

Hand-wing index17.2

Kipp's distance10.4 mm

Secondary length49.9 mm

Tail length52 mm

Tarsus length20 mm

Wing length61 mm

Diet & foraging7

Ground30 %

Invertebrate60 %

Midhigh20 %

Nectar40 %

Trophic levelomnivore

Trophic nicheInvertivore

Understory50 %

Habitat & environment4

HabitatForest

Migration1.0

Primary lifestyleInsessorial

Range size147 km²

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anabathmis hartlaubii has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.30%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 3 variable positions, in barcode order

94Tvariable

206Cvariable

655Avariable

GACCCTATACCTAATCTTTGGTGCATGAGCCGGGATAGTAGGTACCGCCCTAAGCCTCCTTATCCGAGCGGAACTAGGACAACCAGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hedydipna collarissame family8.2%Dreptes thomensissame family9.3%Cinnyris venustussame family9.3%Cinnyris jugularissame family9.4%Cyanomitra verticalissame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type387 records

Wild obs. + sensor357

Museum / vouchered30

Range

Area of Occupancy AOO152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 21≤1 km 11

32 georeferenced · 325 without coordinates

Open the mapobservation + sensor357

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigação Científica Tropicallocation not on record	12
Geneva, CH	11
Copenhagen, DK	2
Ann Arbor, US	2

4 institutions · 27 of 30 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)