Anabasis brevifolia

C.A.Mey. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Anabasis

At a glance

Occurrence records462

Data sources9

Biological traits18

DNA specimens12

eDNA detections6

Sources9 archives

Databases and archives Anabasis brevifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility462 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionNPASS19 compounds

Occurrence & distributionGBIF462 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Anabasis brevifolia C.A.Mey. – gatunek rośliny z rodziny szarłatowatych. Występuje naturalnie w Kazachstanie, Rosji (południowo-zachodnia część Syberii, Mongolii oraz zachodnich Chinach.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.2 m

Plant height max0.25 m

Plant height min0.05 m

Life cycle & reproduction5

Deciduousnessdeciduous

Flowering endAug

Flowering startJul

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatetemperate

Growth formshrub

Habitat GIFTmountains, saline places, stony places

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)275 mg/g

Leaf p0.6 mg/g

Photosynthetic pathwayC4

Specific leaf area (SLA)8.62 mm²/mg

03Chemical composition19 compounds

Compounds documented for Anabasis brevifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Chalcones9

Simple indole alkaloids3

Flavanones1

Simple phenolic acids1

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(2s)-7-Hydroxy-5-methoxy-6,8-dimethyl flavanone	present	NPASS
1-(2-Hydroxy-4,6-dimethoxyphenyl)-3-phenylpropan-1-one	present	NPASS
1-Propanone, 1-(2,4-dihydroxy-3-((2-hydroxyphenyl)methyl)-6-methoxy-5-methylphenyl)-3-phenyl-	present	NPASS
Angoletin	present	NPASS
Angoluvarin	present	NPASS
Benzoic acid	present	NPASS
Chamuvaritin	present	NPASS
Diuvaretin	present	NPASS
DVQKSIMSTILIJZ-BJYRRAHNSA-N	present	NPASS
Isouvaretin	present	NPASS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anabasis brevifolia has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes5

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV900438.1 ↗481 bpChina · 2018

ACGT

TATGCGATATCTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACG …

Anabasis brevifolia isolate XB_HM267 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS9★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anabasis brevifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Lomonosova, M. N. & A. A. Krasnikov. 1993. Chromosome numbers in some members of the Chenopodiaceae. Bot. Žhurn. (Moscow & Leningrad) 78(3): 158–159.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type462 records

Wild obs. + sensor289

Museum / vouchered173

Range

Area of Occupancy AOO1 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 38≤1 km 48≤10 km 41>10 km 9

136 georeferenced · 153 without coordinates

Open the mapobservation + sensor289

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 3≤1 km 15≤10 km 2>10 km 2

22 georeferenced · 151 without coordinates

Open the institutions mapphysical evidence173

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	39
Moscow State Universitylocation not on record	36
Jiangxi College of Educationlocation not on record	14
Yangling, CN	13
Lanzhou, CN	11
Lanzhou Institute of Desert Research, Academia Sinicalocation not on record	9
Inner Mongolia Universitylocation not on record	6
Shanxi Universitylocation not on record	5
Urumqi, CN	4
Urumqi, CN	3
WNNUlocation not on record	3
Nanjing, CN	2
GJOlocation not on record	1
Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record	1
Turpan Eremophytes Botanical Garden, Herbariumlocation not on record	1
Guilin, CN	1
Kunming, CN	1
IATMlocation not on record	1
Beijing Normal Universitylocation not on record	1
Guangzhou, CN	1
Herbarium of South China Botanical Gardenlocation not on record	1
Frankfurt am Main	1

22 institutions · 155 of 173 vouchered records shown · 16 without an institution code

09Environmental DNA6 detections

Where the DNA of Anabasis brevifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

Desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C -4.20–25.4

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 1.50–31.1

Min temp (night)3.10 °C -10.4–18.5

Precipitation13.8 mm/mo 6.50–22.5

Air humidity45.7 % 39.5–50.1

Moisture balance-95.2 mm/mo -139–-35.1

Vapour deficit827 Pa 344–2,357

Wind speed3.70 m/s 2.40–4.50

Cloud cover24.8 % 24.1–37.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)