Anabasis articulata

(Forssk.) Moq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Anabasis

At a glance

Occurrence records3 967

Data sources9

Biological traits14

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Anabasis articulata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 967 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF3 967 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Anabasis articulata est une espèce de plante du genre Anabasis et de la famille des amaranthacées. Elle est répandue en Algérie où elle appréciée en médecine traditionnelle comme antidiabétique et comme anti-inflammatoire.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height0.17 m

Seed mass2.68 mg

⚠ sources differ — TRY: 2.68 mg · GIFT: 2.23 mg

Seed mass max4.49 mg

Seed mass min0.68 mg

Life cycle & reproduction3

Deciduousnessevergeen

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: xerohalophyte

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC4

03Chemical composition2 compounds

Compounds documented for Anabasis articulata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Aminoacids1

Oleanane triterpenoids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Betaine		present	LOTUS
Oleanolic acid		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anabasis articulata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences5

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKX262572.1 ↗606 bpSpain · 2001

ACGT

TCGAAACCTGCCCAGCAGATTGACTAGCGAACTCGTTCATCATCCACGGGGCGGGGCTGCGGTCGCGACTCGTCGCGCCGTGCCTCGTCC …

Anabasis articulata voucher J. Hansen s.n., KAS internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anabasis articulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015

CCDB · book-ipcn67-71 — MURIN, A., & I.I. CHAUDHRI. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269. 70-322 NAG, K.K., & B.M. JOHRI. 1969. Organogenesis and chromosomal constitution in embryo callus of Nuytsia floribunda. Phytomorphology 19: 405-408.

CCDB · CromoCat 2015 — Murín, A. & A. Chaudhri. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXVI]. Taxon 19(2): 266-268.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 967 records

Wild obs. + sensor3 789

Museum / vouchered177

Other1

Origin

Native49

Range

Area of Occupancy AOO5 476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 374≤1 km 80≤10 km 459>10 km 9

922 georeferenced · 2 867 without coordinates

Open the mapobservation + sensor3 789

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 7≤1 km 30≤10 km 50>10 km 1

88 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence177

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	34
College of the Atlantic, Museumlocation not on record	22
València, ES	16
Barcelona, ES	15
Wlocation not on record	14
Rishon Le Zion, IL	11
Granada, ES	8
Alicante, ES	7
Salamanca, ES	4
EEZA-CSIClocation not on record	4
Madrid, ES	3
Moscow State Universitylocation not on record	3
Entomological Society of Latvialocation not on record	3
Badajoz, ES	3
ISAlocation not on record	2
Uniwersytet Śląski w Katowicachlocation not on record	2
Phyletisches Museum Jenalocation not on record	2
Sevilla, ES	2
San Sebastián, ES	2
Madrid, ES	2
Edinburgh, GB	2
Universidad del Pais Vasco (UPV/EHU)location not on record	1
BRNUlocation not on record	1
Paris, FR	1
Uniwersytet Jagiellońskilocation not on record	1
Córdoba, ES	1
Pamplona, ES	1
Museo Achille Folettolocation not on record	1
LDlocation not on record	1
Vitoria, ES	1
BClocation not on record	1

31 institutions · 171 of 177 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Anabasis articulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anabasis articulata

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction3

Diet & foraging1

Habitat & environment5

Physiology & chemistry1

Compound class profile2 classes

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 967 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 967 records