Anabasis aphylla

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Anabasis

At a glance

Occurrence records571

Data sources13

Biological traits18

DNA specimens9

eDNA detections7

Sources13 archives

Databases and archives Anabasis aphylla's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility571 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS56 compounds

Occurrence & distributionGBIF571 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Anabasis aphylla is a species of flowering plant in the family Amaranthaceae, native to the region surrounding the Caspian Sea, Central Asia, and Xinjiang and western Gansu provinces of China. A many-branched shrub usually found growing in alluvial fans and dune swales, it is sometimes planted to catch blowing soil and stabilize sand dunes. The alkaloid anabasine was named for this toxic species, from which it was first isolated by Orechoff and Menschikoff in the year 1931. Anabasine was widely used as an insecticide in the former Soviet Union until 1970.Ujváry, István, Pest Control Agents from Natural Products - Chapter 3 of Hayes' Handbook of Pesticide Toxicology (Third Edition), ed. Robert Krieger, pub. Academic Press 2010.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.533 m

Plant height max0.75 m

Plant height min0.3 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Growth formshrub

Habitat GIFTold fields, saline places, sand

Mycorrhiza typenon-mycorrhizal

Woodinesswoody

Physiology & chemistry5

Leaf dry-matter content (LDMC)282 mg/g

Leaf n14 mg/g

Leaf p1.25 mg/g

Photosynthetic pathwayC4

Specific leaf area (SLA)3.14 mm²/mg

03Chemical composition56 compounds

Compounds documented for Anabasis aphylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile4 classes

Quinolizidine alkaloids10

Piperidine alkaloids $ Pyridine alkaloids3

Pyridine alkaloids1

Germacrane sesquiterpenoids1

Documented compounds56 total

Tissue Source Quantified only

Compound	Class	Amount	Source
ALKALOIDS		20,000 ppm	DukesPhytochem

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anabasis aphylla has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV900430.1 ↗367 bpChina · 2018

ACGT

TGCGCCCGAAGCCTTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCTCCCCCAACCCACCCCGCGTGGGACTTGGGGGA …

Anabasis aphylla isolate XB_HM2737 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS9★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Anabasis aphylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · Automatic manuscript search

CCDB · Automatic manuscript search — S. Ghaffari,Zhila Balaei,T. Chatrenoor and H. Akhani. 2015. "Cytology of SW Asian Chenopodiaceae: new data from Iran and a review of previous records and correlations with life forms and C4 photosynthesis". Plant Systematics and Evolution 301:501-521.

08Occurrence & distribution

Record type571 records

Wild obs. + sensor231

Museum / vouchered340

Range

Area of Occupancy AOO1 456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 89≤1 km 21≤10 km 14>10 km 18

142 georeferenced · 89 without coordinates

Open the mapobservation + sensor231

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 32≤1 km 13≤10 km 21>10 km 8

74 georeferenced · 266 without coordinates

Open the institutions mapphysical evidence340

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	85
Moscow State Universitylocation not on record	75
Yangling, CN	16
Urumqi, CN	15
Nanjing, CN	14
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	14
Guangzhou, CN	10
BRNUlocation not on record	8
Siouxland Heritage Museumlocation not on record	7
Kunming, CN	6
Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record	5
Lanzhou Institute of Desert Research, Academia Sinicalocation not on record	5
WNNUlocation not on record	5
Chengdu, CN	4
Paris, FR	3
Lanzhou, CN	3
Xining, CN	2
Karlsruhe, DE	2
Wlocation not on record	2
Urumqi, CN	2
Sevilla, ES	1
LDlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Shanghai, CN	1
Oskarshamn, SE	1
Bronx, US	1
Barcelona, ES	1
Guilin, CN	1
Academy of Sciences of the Republic of Uzbekistanlocation not on record	1

30 institutions · 293 of 340 vouchered records shown · 43 without an institution code

09Environmental DNA7 detections

Where the DNA of Anabasis aphylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–18.9

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 15.7–24.0

Min temp (night)3.10 °C 3.10–12.9

Precipitation13.8 mm/mo 13.8–41.5

Air humidity45.7 % 45.7–48.9

Moisture balance-95.2 mm/mo -98.9–-95.2

Vapour deficit827 Pa 827–1,246

Wind speed4.50 m/s 3.10–4.50

Cloud cover24.1 % 24.1–28.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)