Amyris madrensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Amyris

At a glance

Occurrence records526

Data sources8

Biological traits13

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Amyris madrensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility526 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionNPASS24 compounds

Occurrence & distributionGBIF526 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Amyris madrensis là một loài thực vật có hoa trong họ Cửu lý hương. Loài này được S.Watson mô tả khoa học đầu tiên năm 1890.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass251 mg

Seed mass max251 mg

Seed mass min251 mg

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition24 compounds

Compounds documented for Amyris madrensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Eudesmane sesquiterpenoids10

Arylnaphthalene and aryltetralin lignans1

Cinnamic acids and derivatives1

Flavones1

Apocarotenoids(ε-) $ Megastigmanes1

Documented compounds24 total

Compound	Amount	Source
(1S,4aR,7R,8aR)-7-(1-hydroxy-1-methyl-ethyl)-1,4a-dimethyl-decalin-1-ol	present	NPASS
(3aR,5aR,9aR,9bR)-3a,9a-dihydroxy-5a-methyl-3,9-dimethylidene-4,5,6,7,8,9b-hexahydrobenzo[g][1]benzofuran-2-one	present	NPASS
(3aR,5aR,9bR)-5a,9-dimethyl-3-methylidene-4,5,6,7,8,9b-hexahydro-3aH-benzo[g][1]benzofuran-2-one	present	NPASS
(3aR,5aS,9bS)-3a-hydroxy-5a,9-dimethyl-3-methylidene-5,6,7,9b-tetrahydro-4H-benzo[g][1]benzofuran-2,8-dione	present	NPASS
(3R,3aR,5aR,8R,9bR)-3a,8-dihydroxy-3,5a,9-trimethyl-3a,4,5,5a,6,7,8,9b-octahydronaphtho[1,2-b]furan-2(3H)-one	present	NPASS
(3R,3aR,5aR,9bS)-3a-hydroxy-3,5a,9-trimethyl-4,5,6,7,8,9b-hexahydro-3H-benzo[g][1]benzofuran-2-one	present	NPASS
(3R,3aR,5aS,7S,9bS)-3a,7-dihydroxy-3,5a,9-trimethyl-4,5,6,7,8,9b-hexahydro-3H-benzo[g][1]benzofuran-2-one	present	NPASS
2-[(2R,4aS,6S,8aS)-6-hydroxy-4a-methyl-8-methylidene-1,2,3,4,5,6,7,8a-octahydronaphthalen-2-yl]prop-2-enoic acid	present	NPASS
3-(4-Methoxyphenyl)-2-propenal	present	NPASS
5-hydroxy-7-methoxy-2-phenyl-6-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]chromen-4-one	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amyris madrensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOL537530.1 ↗553 bpUSA · 2019

ACGT

GAGTGTTGGATTCAAGGCCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGTAACCAAAGATACTGATATCTTGGCAGC …

Amyris madrensis voucher BRIT:Gostel461 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1

plant barcode

08Occurrence & distribution

Record type526 records

Wild obs. + sensor376

Museum / vouchered150

Range

Area of Occupancy AOO728 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 253≤1 km 47≤10 km 7>10 km 13

320 georeferenced · 56 without coordinates

Open the mapobservation + sensor376

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 84≤1 km 2≤10 km 11>10 km 4

101 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence150

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	30
Durango, MX	24
Mexico City, MX	14
Mexico City, MX	13
Juriquilla, MX	12
La Paz, MX	7
San Diego, US	6
Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record	5
Bronx, US	4
University of Stellenboschlocation not on record	3
Austin, US	3
Saint Louis, US	3
Jena Microbial Resource Collectionlocation not on record	2
Chapingo, MX	2
Chicago, US	2
Ensenada, MX	2
Wuzhou, CN	1
Montecillo, Texcoco, MX	1
Riverside, US	1
LDlocation not on record	1
Chadron, US	1
Mérida, MX	1
Calabar, NG	1
MEXUlocation not on record	1
ASUlocation not on record	1
Linares, MX	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Fort Worth, US	1

28 institutions · 144 of 150 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Amyris madrensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 26.9–26.9

Seasonal swing summer↔winter18.6 °C

Max temp (day)32.0 °C

Min temp (night)22.4 °C

Precipitation119 mm/mo

Air humidity59.8 %

Moisture balance-70.8 mm/mo

Vapour deficit1,430 Pa

Wind speed3.60 m/s

Cloud cover29.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.