Amynthas corticis

(Kinberg, 1866) · species

image placeholder — illustration coming later

Animalia/Annelida/Clitellata/Crassiclitellata/Megascolecidae/Amynthas

At a glance

Occurrence records329

Data sources10

Biological traits0

DNA specimens212

eDNA detections295

Sources10 archives

Databases and archives Amynthas corticis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility293 records↗

OBISOcean Biodiversity Information System36 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI295 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics212 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS329 records

Environmental DNA1 datasets · 11 countries295 detections

DNA & barcodingBOLD212 specimens

Genome at a glanceGoaT · NCBI≈1 Gbp

01Narrative

Amynthas corticis is een ringworm uit de familie van de Megascolecidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1867 door Kinberg als Perichaeta corticis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding212 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amynthas corticis has left across the world's sequence archives.

At a glance

DNA specimens212

BINs11

Marker genes12

eDNA detections295

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus188 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 108 variable positions, in barcode order

1Amostly conserved

4Tmostly conserved

13Cmostly conserved

16Tmostly conserved

19Amostly conserved

25Tmostly conserved

43Gmostly conserved

46Tvariable

49Amostly conserved

55Tmostly conserved

58Tmostly conserved

73Amostly conserved

74Tmostly conserved

82Amostly conserved

85Tvariable

88Gvariable

91Amostly conserved

94Cmostly conserved

97Gmostly conserved

102Gmostly conserved

103Tmostly conserved

112Tvariable

118Cmostly conserved

133Amostly conserved

142Cvariable

143Tmostly conserved

154Tmostly conserved

163Amostly conserved

169Amostly conserved

181Tmostly conserved

184Tvariable

190Tmostly conserved

193Tvariable

197Cmostly conserved

200Tmostly conserved

208Tmostly conserved

212Tmostly conserved

214Gvariable

217Gvariable

220Tmostly conserved

235Tmostly conserved

250Tmostly conserved

259Cmostly conserved

268Avariable

271Cvariable

274Cvariable

277Amostly conserved

280Cmostly conserved

284Tvariable

287Cvariable

301Amostly conserved

307Gvariable

313Avariable

316Tmostly conserved

319Avariable

337Tvariable

340Cvariable

343Avariable

355Tmostly conserved

358Cvariable

361Tmostly conserved

364Gvariable

370Tmostly conserved

373Amostly conserved

385Tmostly conserved

388Gvariable

403Amostly conserved

412Avariable

415Gmostly conserved

418Amostly conserved

421Amostly conserved

428Cmostly conserved

433Tmostly conserved

436Amostly conserved

439Cmostly conserved

442Tmostly conserved

469Amostly conserved

475Avariable

478Cvariable

483Gmostly conserved

484Amostly conserved

487Amostly conserved

499Cmostly conserved

517Amostly conserved

523Tvariable

526Cmostly conserved

527Gmostly conserved

528Tmostly conserved

529Amostly conserved

532Tmostly conserved

533Cmostly conserved

542Cmostly conserved

556Amostly conserved

559Amostly conserved

562Cvariable

565Tmostly conserved

571Cvariable

581Tmostly conserved

589Tmostly conserved

598Tmostly conserved

607Amostly conserved

616Tmostly conserved

619Avariable

622Avariable

628Gmostly conserved

631Avariable

646Tmostly conserved

652Cvariable

AACTCTATACTTCATTTTAGGAATTTGAGCCGGAATAATTGGGGCTGGAATAAGTCTTCTTATTCGAATCGAATTAAGACAACCTGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.4%

Haplotypes24

BINs9

Most divergent pair18.7%

AsiaOtherAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amynthas tungpuensissame genus13.7%Amynthas distichussame genus14.2%Kanchuria octothecasame family14.3%Amynthas tayalissame genus14.6%Amynthas zhangisame genus14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_027832 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8COX3ND6CYTBATP6ND5ND4LND4ND1ND3ND212S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amynthas corticis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 017 224 661 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amynthas corticis1.02 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness17.4% BUSCO

08Occurrence & distribution

Record type329 records

Wild obs. + sensor34

Museum / vouchered295

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 21≤1 km 2≤10 km 1>10 km 8

32 georeferenced · 2 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 24≤1 km 5≤10 km 28>10 km 3

60 georeferenced · 235 without coordinates

Open the institutions mapphysical evidence295

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BRPRlocation not on record	59
BRSPlocation not on record	27
Comune di Brescialocation not on record	25
Durango, MX	24
Pachhunga University Collegelocation not on record	8
South Kensington, GB	7
BRRSlocation not on record	2
Auckland, NZ	2
Universidad Tecnológica de Pereira (UTP)location not on record	1
Helsinki, FI	1
Departamento de Geologia, Universidad de Chilelocation not on record	1
Kharazmi Universitylocation not on record	1

12 institutions · 158 of 295 vouchered records shown · 99 without an institution code

09Environmental DNA295 detections

Where the DNA of Amynthas corticis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found295

Studies independent surveys1

Countries11

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 295 detections have coordinates

Open the map11 countries0

Forestleaf litter and logsBlack loamy surrounded by sandy soilUrban shared gardenGrasslandrainforest stream habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C -1.20–24.1

Seasonal swing summer↔winter23.3 °C

Max temp (day)18.2 °C 0.9–27.6

Min temp (night)14.5 °C -5.80–21.7

Precipitation283 mm/mo 52.1–344

Air humidity64.1 % 57.9–69.2

Moisture balance225 mm/mo

Vapour deficit732 Pa 202–988

Wind speed2.90 m/s

Cloud cover37.8 % 21.9–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 200 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)