Amyna punctum

(Fabricius, 1794) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Amyna

At a glance

Occurrence records333

Data sources7

Biological traits0

DNA specimens149

eDNA detections163

Sources7 archives

Databases and archives Amyna punctum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility333 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI163 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics149 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF333 records

Environmental DNA1 datasets · 18 countries163 detections

DNA & barcodingBOLD149 specimens

01Narrative

Amyna punctum is a moth of the family Noctuidae first described by Johan Christian Fabricius in 1794. This moth can be found throughout subtropical African countries such as South Africa, Madagascar and Australasian countries like India, Sri Lanka, the Philippines, Borneo and the Andaman Islands.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding149 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amyna punctum has left across the world's sequence archives.

At a glance

DNA specimens149

BINs4

Marker genes1

eDNA detections163

Countries20

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus145 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

46Cmostly conserved

59Tmostly conserved

70Tmostly conserved

79Amostly conserved

85Amostly conserved

160Gmostly conserved

202Amostly conserved

220Cmostly conserved

232Tmostly conserved

235Cmostly conserved

238Cmostly conserved

259Tmostly conserved

266Tmostly conserved

268Amostly conserved

274Tvariable

313Tmostly conserved

349Cvariable

352Gvariable

403Tmostly conserved

406Cmostly conserved

484Gmostly conserved

499Cmostly conserved

508Tmostly conserved

542Tmostly conserved

589Tmostly conserved

616Cmostly conserved

628Gvariable

652Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACCTCTTTAAGATTATTAATTCGAGCTGAATTAGGAACCCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes13

BINs4

Most divergent pair4.9%

AfricaAsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bagisara rectifasciasame family7.0%Bagisara brouanasame family7.0%Amyna tristissame genus7.8%Manoba mesographasame order8.1%Lygropia tripunctatasame order8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type333 records

Wild obs. + sensor196

Museum / vouchered137

Range

Area of Occupancy AOO712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 104≤1 km 24≤10 km 10>10 km 1

139 georeferenced · 57 without coordinates

Open the mapobservation + sensor196

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 3≤10 km 4

7 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	30
Durban Natural Science Museumlocation not on record	19
National Museums of Kenyalocation not on record	17
tesrilocation not on record	17
Taiwan Forestry Research Institutelocation not on record	6
Natural History Museum Rotterdamlocation not on record	5
ZSMlocation not on record	4
Tallinn, EE	4
FACTlocation not on record	3
Research Collection of Egbert Friedrichlocation not on record	2
Chiba, JP	1
Ishikawa Museum of Natural Historylocation not on record	1
JP	1
Museums Victorialocation not on record	1
Muséum d'histoire naturelle de Marseillelocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

16 institutions · 113 of 137 vouchered records shown · 24 without an institution code

09Environmental DNA163 detections

Where the DNA of Amyna punctum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found163

Studies independent surveys1

Countries18

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 163 detections have coordinates

Open the map18 countries0

2. Savanna | 2.1. Dry SavannaMopane/Bushwillow Woodlands4. Native Grassland|4.6. Subtropical/Tropica…1. Forest & Woodland|1.6. Subtropical/Tropic…Alluvial PlainsMopane Shrubveld

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 19.0–26.5

Seasonal swing summer↔winter6.20 °C

Max temp (day)26.1 °C 24.0–30.8

Min temp (night)17.1 °C 13.7–23.2

Precipitation110 mm/mo 48.8–342

Air humidity57.8 % 55.9–65.7

Moisture balance-36.3 mm/mo -88.4–204

Vapour deficit999 Pa 845–1,496

Wind speed2.90 m/s 1.60–4.20

Cloud cover36.1 % 20.3–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 156 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)