Amyna axis

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Amyna

At a glance

Occurrence records822

Data sources6

Biological traits0

DNA specimens128

eDNA detections281

Sources6 archives

Databases and archives Amyna axis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility822 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI281 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics128 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF822 records

Environmental DNA2 datasets · 22 countries281 detections

DNA & barcodingBOLD128 specimens

01Narrative

Amyna axis, the oriental eight-spot, is a moth of the family Noctuidae. The species was first described by Achille Guenée in 1852.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding128 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amyna axis has left across the world's sequence archives.

At a glance

DNA specimens128

BINs2

Marker genes2

eDNA detections281

Countries22

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus116 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

31Avariable

34Avariable

59Cvariable

200Gvariable

220Tvariable

235Tvariable

337Gvariable

400Tvariable

478Cvariable

508Avariable

547Cvariable

568Tvariable

646Tvariable

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCACTTAGATTACTAATTCGAGCTGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes10

BINs2

Most divergent pair2.3%

OceaniaAfricaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amyna spilonotasame genus4.3%Amyna strictasame genus4.6%Amyna bullulasame genus5.9%Amyna onthodessame genus6.2%Mosopia eudoxusalissame order6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type822 records

Wild obs. + sensor552

Museum / vouchered270

Origin

Native3

Range

Area of Occupancy AOO1 344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 239≤1 km 160≤10 km 49>10 km 25

473 georeferenced · 79 without coordinates

Open the mapobservation + sensor552

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 5≤1 km 19≤10 km 43>10 km 12

79 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence270

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CUlocation not on record	39
East Lansing, US	38
Mississippi State, US	24
Museums Victorialocation not on record	18
National Biodiversity Institute, Costa Ricalocation not on record	17
New Haven, US	16
Helsinki, FI	10
Washington, US	8
ZSMlocation not on record	8
Tapachula, MX	6
Auckland, NZ	5
Australian National Fish Collectionlocation not on record	5
Toyota city nature sanctuarylocation not on record	4
SUVlocation not on record	3
Philadelphia, US	3
University of Pennsylvanialocation not on record	2
Gifu prefectural Museumlocation not on record	2
Kawasaki Shi Tama Ku, JP	2
Hiwa Museum of Natural Historylocation not on record	2
The University of the West Indies, Trinidad and Tobagolocation not on record	1
tesrilocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
MZLUlocation not on record	1
Sydney, AU	1

24 institutions · 217 of 270 vouchered records shown · 53 without an institution code

09Environmental DNA281 detections

Where the DNA of Amyna axis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found281

Studies independent surveys2

Countries22

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 281 detections have coordinates

Open the map22 countries0

LembomboÂ Mountain BushveldMopane/Bushwillow Woodlands1. Forest & Woodland|1.7. Subtropical/tropic…4. Native Grassland|4.6. Subtropical/Tropica…8. Desert | 8.1. Hot DesertMopaneÂ Shrubveld

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 20.6–28.9

Seasonal swing summer↔winter7.80 °C

Max temp (day)28.2 °C 25.6–34.4

Min temp (night)19.4 °C 15.4–25.2

Precipitation92.1 mm/mo 22.2–177

Air humidity56.8 % 52.8–63.6

Moisture balance-66.0 mm/mo -117–25.6

Vapour deficit1,202 Pa 1,029–1,885

Wind speed3.10 m/s 1.90–4.20

Cloud cover23.2 % 11.9–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 276 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)