Amylotheca dictyophleba

(F.Muell.) Tiegh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Loranthaceae/Amylotheca

At a glance

Occurrence records1 611

Data sources10

Biological traits33

DNA specimens4

eDNA detections3

Sources10 archives

Databases and archives Amylotheca dictyophleba's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 611 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF1 611 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT13.4 Gbp

01Narrative

Amylotheca dictyophleba là một loài thực vật có hoa trong họ Loranthaceae. Loài này được (F.Muell.) Tiegh. mô tả khoa học đầu tiên năm 1894.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology11

Fruit length10 mm

⚠ sources differ — AusTraits: 10 mm · GIFT: 8.7 mm

Fruit width10 mm

⚠ sources differ — AusTraits: 10 mm · GIFT: 8.7 mm

Leaf length90 mm

Leaf length max130 mm

Leaf length min60 mm

Leaf size5 040 mm²

Leaf width40 mm

Leaf width max60 mm

Leaf width min20 mm

Petiole length0.5 cm

Seed mass36 mg

Life cycle & reproduction8

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyyyyyynnnnnn

Life formhemiparasitic shrub

Life spanperennial

Pollination syndromebird

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

⚠ sources differ — AusTraits: berry · GIFT: drupe

Growth formshrub

Habitat GIFTrain forest

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amylotheca dictyophleba has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895635.1 ↗513 bpAustralia · 2012

ACGT

ACTTATTATACTCCTGATTATGAAACTAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAGGAA …

Amylotheca dictyophleba voucher 1076418209 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLatrnH-psbA

plant barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Amylotheca dictyophleba carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size13 398 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Amylotheca dictyophleba13.4 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 243×GoaT · Kew Plant DNA C-values Database · CCDB · kew · CCDB · Cave1963

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Martin NJ. 1983. Nuclear DNA varition in the Australasian Loranthaceae. In Biology of mistletoes (ed. M Calder & P. Berhnhardt), pp. 277-293, Sydney: Academic Press.

CCDB · Cave1963 — Barlow 1963

n 121×CCDB · Cave1963

CCDB · Cave1963 — Barlow 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 611 records

Wild obs. + sensor682

Museum / vouchered864

Other65

Origin

Native94

Range

Area of Occupancy AOO3 592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 406≤1 km 94≤10 km 35>10 km 32

567 georeferenced · 115 without coordinates

Open the mapobservation + sensor682

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 126≤1 km 131≤10 km 254>10 km 86

597 georeferenced · 267 without coordinates

Open the institutions mapphysical evidence864

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	234
Smithfield, AU	198
Mount Annan, AU	92
Museo Entomologico de Leonlocation not on record	80
Canberra, AU	79
Paris, FR	33
Adelaide, AU	13
Armidale, AU	13
Kew, GB	11
Palmerston, AU	11
Zürich, CH	11
Saint Louis, US	8
John T. Waterhouse Herbariumlocation not on record	7
Wollongong, AU	5
Hobart, AU	4
James Cook Townsvillelocation not on record	4
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Honolulu, US	3
Wlocation not on record	2
Auckland, NZ	2
Beijing, CN	2
Wellington, NZ	1
Université de Strasbourglocation not on record	1
Guangzhou, CN	1
Australian Tropical Herbariumlocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Plocation not on record	1
La Trobe Universitylocation not on record	1

28 institutions · 823 of 864 vouchered records shown · 40 without an institution code

09Environmental DNA3 detections

Where the DNA of Amylotheca dictyophleba was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 22.5–25.9

Seasonal swing summer↔winter8.90 °C

Max temp (day)28.5 °C 27.1–28.9

Min temp (night)22.7 °C 16.5–23.1

Precipitation237 mm/mo 59.8–366

Air humidity61.3 % 47.0–66.9

Moisture balance53.3 mm/mo -103–160

Vapour deficit1,206 Pa 1,101–1,540

Wind speed4.00 m/s 1.50–5.20

Cloud cover34.0 % 21.3–52.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amylotheca dictyophleba

At a glance

Sources10 archives

Size & morphology11

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 611 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 611 records