Amyema maidenii

(Blakely) Barlow · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Loranthaceae/Amyema

At a glance

Occurrence records400

Data sources11

Biological traits34

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Amyema maidenii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility400 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF400 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT9.4 Gbp

01Narrative

Amyema maidenii is a species of flowering plant within the genus Amyema, an epiphytic hemiparasitic plant of the family Loranthaceae native to Australia and found Australia-wide in the inland (but not in Victoria nor Tasmania). ''A. maidenii'' on mulga (''[[Acacia aneura]]'') ''A. maidenii'': fruit

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length8 mm

Leaf length34.03 mm

Leaf length max60 mm

Leaf length min20 mm

Leaf mass92.13 mg

Leaf mass per area312 g/m2

Leaf size372 mm²

Leaf width15.65 mm

Leaf width max23 mm

Leaf width min5 mm

Petiole length0.55 cm

Plant height3 m

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnnnnnnnn

Life formhemiparasitic epiphyte

Life spanperennial

Pollination syndromebird+insect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteobligatory

⚠ sources differ — TRY: Parasite · GIFT: independent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapeoblanceolate ovate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)3 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amyema maidenii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHM116952.1 ↗802 bpAustralia

ACGT

GGCGGTACGCTGCCCGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAA …

Amyema maidenii internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Amyema maidenii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size9 388 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Amyema maidenii9.39 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×GoaT · Kew Plant DNA C-values Database · CCDB · kew · CCDB · Cave1963

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Martin NJ. 1983. Nuclear DNA varition in the Australasian Loranthaceae. In Biology of mistletoes (ed. M Calder & P. Berhnhardt), pp. 277-293, Sydney: Academic Press.

CCDB · Cave1963 — Barlow 1963

n 91×CCDB · Cave1963

CCDB · Cave1963 — Barlow 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type400 records

Wild obs. + sensor334

Museum / vouchered64

Other2

Origin

Native8

Range

Area of Occupancy AOO1 252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 228≤1 km 15≤10 km 43>10 km 9

295 georeferenced · 39 without coordinates

Open the mapobservation + sensor334

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 12≤1 km 7≤10 km 13>10 km 3

35 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	11
John T. Waterhouse Herbariumlocation not on record	7
Kew, GB	6
Palmerston, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Museo Entomologico de Leonlocation not on record	3
EL PASO, US	3
Mount Annan, AU	3
Guangzhou, CN	3
Armidale, AU	3
Auckland, NZ	3
Beijing, CN	2
Kensington, AU	1
IPA/SPlocation not on record	1
Claremont, US	1
UnBlocation not on record	1
STUlocation not on record	1
JBRJlocation not on record	1
University of Stellenboschlocation not on record	1
La Trobe Universitylocation not on record	1
Canberra, AU	1
MeiseBGlocation not on record	1

22 institutions · 63 of 64 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Amyema maidenii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)