Amyema cambagei

(Blakely) Danser · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Loranthaceae/Amyema

At a glance

Occurrence records1 712

Data sources11

Biological traits24

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Amyema cambagei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 712 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF1 712 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT12.2 Gbp

01Narrative

Amyema cambagei, commonly known as sheoak mistletoe, is a species of flowering plant, an epiphytic hemiparasitic plant of the family Loranthaceae endemic to Australia, and found in New South Wales and Queensland in sclerophyll forest and woodland on several species of Casuarinaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology4

Fruit length5.5 mm

Fruit width5.5 mm

Leaf length105 mm

Leaf width1.15 mm

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life formhemiparasitic epiphyte

Life spanperennial

Pollination syndromeabiotic+insect+vertebrate

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteobligatory

⚠ sources differ — TRY: Parasite · GIFT: independent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Leaf shapeterete

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amyema cambagei has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ333833.1 ↗645 bp

ACGT

TCGAAACCTGCACAGCAGAGCGACCCGTGGACACGTTCGATCGACGGGCGGGGGAGCGACGCGCGGGACTCTCGCTCGTACGCCCCCCCG …

Amyema cambagei internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Amyema cambagei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size12 225 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Amyema cambagei12.23 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Martin NJ. 1983. Nuclear DNA varition in the Australasian Loranthaceae. In Biology of mistletoes (ed. M Calder & P. Berhnhardt), pp. 277-293, Sydney: Academic Press.

n 91×CCDB · Cave1963

CCDB · Cave1963 — Barlow 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 712 records

Wild obs. + sensor1 080

Museum / vouchered615

Other17

Origin

Native181

Range

Area of Occupancy AOO4 000 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 680≤1 km 144≤10 km 36>10 km 22

882 georeferenced · 198 without coordinates

Open the mapobservation + sensor1 080

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 138≤1 km 84≤10 km 202>10 km 65

489 georeferenced · 126 without coordinates

Open the institutions mapphysical evidence615

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	180
Brisbane, AU	131
Canberra, AU	103
Museo Entomologico de Leonlocation not on record	50
Armidale, AU	34
Adelaide, AU	19
NSW Dept of Planning, Industry and Environmentlocation not on record	16
Smithfield, AU	11
Kew, GB	8
Wollongong, AU	8
Batemans Bay, AU	8
NSW Office of Environment and Heritagelocation not on record	7
John T. Waterhouse Herbariumlocation not on record	6
Palmerston, AU	5
James Cook Townsvillelocation not on record	2
DPIlocation not on record	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
IPA/SPlocation not on record	1
Kensington, AU	1
Hobart, AU	1
University of Stellenboschlocation not on record	1
Departamento de Sistematica e Ecologialocation not on record	1

22 institutions · 596 of 615 vouchered records shown · 19 without an institution code

09Environmental DNA2 detections

Where the DNA of Amyema cambagei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 19.8–19.8

Seasonal swing summer↔winter15.2 °C

Max temp (day)25.5 °C

Min temp (night)14.2 °C

Precipitation49.1 mm/mo

Air humidity52.1 %

Moisture balance-92.3 mm/mo

Vapour deficit1,165 Pa

Wind speed4.10 m/s

Cloud cover23.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amyema cambagei

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 712 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 712 records