Amyema bifurcata

(Benth.) Tiegh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Loranthaceae/Amyema

At a glance

Occurrence records855

Data sources9

Biological traits30

DNA specimens2

eDNA detections1

Sources9 archives

Databases and archives Amyema bifurcata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility855 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF855 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Amyema bifurcata is an epiphytic, flowering, hemiparasitic plant of the family Loranthaceae native to Australia and found in Western Australia, the Northern Territory, Queensland and New South Wales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology10

Fruit length10 mm

Fruit width9.5 mm

Leaf length180 mm

Leaf length max400 mm

Leaf length min60 mm

Leaf width13 mm

Leaf width max25 mm

Leaf width min4 mm

Petiole length2.5 cm

Seed length7 mm

Life cycle & reproduction7

Dispersal typeanimal

Flowering timennnnnyyynnnn

Life formhemiparasitic epiphyte

Life spanperennial

Pollination syndromeabiotic+insect+vertebrate

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Leaf compoundnesssimple

Leaf shapefalcate lanceolate linear

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amyema bifurcata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW139196.1 ↗355 bp

ACGT

CGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCGGGCCGAGGGCACGCCTGCCTGGGCGTCACGCGTTTCGTCGCCCC …

Amyema bifurcata isolate Amy-bif-seq3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS3trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Amyema bifurcata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · kew

CCDB · kew — Martin NJ. 1983. Nuclear DNA varition in the Australasian Loranthaceae. In Biology of mistletoes (ed. M Calder & P. Berhnhardt), pp. 277-293, Sydney: Academic Press.

n 92×CCDB · Cave1963

CCDB · Cave1963 — Barlow 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type855 records

Wild obs. + sensor328

Museum / vouchered513

Other14

Origin

Native62

Range

Area of Occupancy AOO2 512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 151≤1 km 20≤10 km 8>10 km 7

186 georeferenced · 142 without coordinates

Open the mapobservation + sensor328

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 118≤1 km 45≤10 km 201>10 km 47

411 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence513

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	108
Palmerston, AU	100
Kensington, AU	73
Museo Entomologico de Leonlocation not on record	48
Canberra, AU	44
Mount Annan, AU	40
Armidale, AU	21
Smithfield, AU	19
Adelaide, AU	19
James Cook Townsvillelocation not on record	15
Kew, GB	7
Saint Louis, US	4
Hobart, AU	3
University of Stellenboschlocation not on record	3
NSW Dept of Planning, Industry and Environmentlocation not on record	1
IPA/SPlocation not on record	1
University of the Sunshine Coastlocation not on record	1

17 institutions · 507 of 513 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Amyema bifurcata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 22.6–22.6

Seasonal swing summer↔winter8.70 °C

Max temp (day)24.8 °C

Min temp (night)20.4 °C

Precipitation122 mm/mo

Air humidity59.4 %

Vapour deficit1,107 Pa

Cloud cover20.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)