Amydrium medium

(Zoll. & Moritzi) Nicolson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Amydrium

At a glance

Occurrence records241

Data sources9

Biological traits11

DNA specimens7

eDNA detections4

Sources9 archives

Databases and archives Amydrium medium's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility241 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF241 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 60

01Narrative

Amydrium medium is a flowering plant in genus Amydrium of the arum family, Araceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Deciduousnessevergreen

Life formliana

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)22.32 mm²/mg

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amydrium medium has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes2

GenBank sequences2

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMK206624.1 ↗1 374 bp

ACGT

GATTACAAATTGACTTATTATACTCCTGACTATGAGACAAAAGATACTGATATCNTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTT …

Amydrium medium voucher Chase M 9976 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Amydrium medium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Chromosome records60–602n range60median60mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 603×CCDB · ipcn-api-dl · CCDB · araceae · CCDB · book-fedorov

CCDB · ipcn-api-dl — Petersen, G. 1989. Cytology and systematics of Araceae. Nordic J. Bot. 9: 119–166.

CCDB · araceae — Petersen, 1989

CCDB · book-fedorov — Jones G. E .. 195i

08Occurrence & distribution

Record type241 records

Wild obs. + sensor125

Museum / vouchered116

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 51≤1 km 14≤10 km 11>10 km 19

95 georeferenced · 30 without coordinates

Open the mapobservation + sensor125

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 1≤10 km 7

8 georeferenced · 108 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	25
South Kensington, GB	15
Cibinong Science Center, Herbarium Bogorienselocation not on record	7
Philadelphia, US	5
Cambridge, US	5
Xiamen, CN	4
Saint Louis, US	3
University of Stellenboschlocation not on record	3
Université de Bordeauxlocation not on record	2

9 institutions · 69 of 116 vouchered records shown · 47 without an institution code

09Environmental DNA4 detections

Where the DNA of Amydrium medium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C

Min temp (night)22.6 °C

Precipitation269 mm/mo

Air humidity68.1 %

Moisture balance133 mm/mo

Vapour deficit1,080 Pa

Wind speed1.20 m/s

Cloud cover57.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)