Amsinckia vernicosa

Hook. & Arn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Boraginaceae/Amsinckia

At a glance

Occurrence records174

Data sources12

Biological traits13

DNA specimens2

eDNA detections4

Sources12 archives

Databases and archives Amsinckia vernicosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility174 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF174 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Amsinckia vernicosa is a species of fiddleneck known by the common name green fiddleneck. It is endemic to California, where it is an uncommon member of mountain, desert, and valley habitat in several regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Seed mass2.7 mg

Seed mass max2.7 mg

Seed mass min2.7 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition6 compounds

Compounds documented for Amsinckia vernicosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Pyrrolizidine alkaloids5

Cinnamic acids and derivatives1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
4-(2-Propen-1-yl)phenyl 6-O-D-apio-beta-D-furanosyl-beta-D-glucopyranoside	present	LOTUS
7-Acetylintermedine	present	LOTUS
[(1R,8R)-7-(hydroxymethyl)-2,3,5,8-tetrahydro-1H-pyrrolizin-1-yl] (2S)-2-hydroxy-2-[(1S)-1-hydroxyethyl]-3-methylbutanoate	present	LOTUS
Intermedine	present	LOTUS
Lycopsamine	present	LOTUS
Supinine	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amsinckia vernicosa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP027090.1 ↗624 bp

ACGT

TCGAATCCTGCATAGCAGTACCACTCGCGAACAAGTTCACAAACGAGGGCCGGACCGGGTGTGGGGGATTATATTCCTCACCCTCGATGC …

Amsinckia vernicosa internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Amsinckia vernicosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 148×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Schoen, D. J., M. O. Johnston, A. L'Heureux & J. V. Marsolais. 1997. Evolutionary history of the mating system in Amsinckia (Boraginaceae). Evolution 51: 1090–1099.

CCDB · book-fedorov — Ray P. M. 1954

CCDB · book-fedorov — Ray P. M., Chisaki 1957 .

CCDB · book-fedorov — Ray P. M., Chisaki 1957

CCDB · book-atlas-flowering-plants

n 71×CCDB · Cave1957

CCDB · Cave1957 — Ray & Ohisaki a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.981 ↗

08Occurrence & distribution

Record type174 records

Wild obs. + sensor34

Museum / vouchered140

Origin

Native1

Range

Area of Occupancy AOO428 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 18≤1 km 1≤10 km 2>10 km 2

23 georeferenced · 11 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 4≤1 km 38≤10 km 33

75 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	23
Claremont, US	16
San Luis Obispo, US	16
Fredericton Stock Culture Collectionlocation not on record	10
Davis, US	10
Riverside, US	10
San Diego, US	7
San Francisco, US	5
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	5
CASlocation not on record	4
Canadian Department of Agriculturelocation not on record	4
Severin-McDaniel Insect Collectionlocation not on record	3
Bloomington, US	3
Chongqing Museumlocation not on record	3
ASUlocation not on record	2
Arcata, US	2
Provo, US	2
San Bernardino, US	2
US	2
Boise, US	1
San Jose, US	1
Los Angeles, US	1
Saint Louis, US	1
Phoenix, US	1
Turlock, US	1
Wuzhou, CN	1
Angwin, US	1

27 institutions · 137 of 140 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Amsinckia vernicosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)