Amsinckia calycina

(Moris) Chater · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Boraginaceae/Amsinckia

At a glance

Occurrence records1 231

Data sources11

Biological traits38

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Amsinckia calycina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 231 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF1 231 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Amsinckia calycina, also known as hairy fiddleneck or yellow burweed, is a species of fiddleneck. It is native to Argentina and Chile and naturalised in Australia. It is an annual herb, growing to between 15 and 50 cm high and has pale yellow flowers. The species is poisonous to mammals.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology13

Fruit length2.25 mm

Leaf length62.5 mm

Leaf length max200 mm

Leaf length min25 mm

Leaf width15 mm

⚠ sources differ — AusTraits: 15 mm · GIFT: 30 mm

Leaf width max25 mm

Leaf width min5 mm

Plant height0.5 m

Plant height max1 m

Plant height min0.15 m

Seed length2.5 mm

Seed length max2.5 mm

Seed length min2.5 mm

Life cycle & reproduction9

Deciduousnessdeciduous

Dispersal typeunspecialized

Flowering endJul

Flowering startJun

Flowering timennnnnnnnyyyn

Life formannual

Life spanannual

Raunkiær life formtherophyte

Reproduction asexualabsent

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max4 500 m

Elevation min0 m

Epiphyteterrestrial

Fruit typemericarp

Growth formherb

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapelanceolate linear oblanceolate

Mycorrhizaabsent

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Amsinckia calycina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Pyrrolizidine alkaloids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Intermedine		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amsinckia calycina has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences3

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKF849140.1 ↗600 bpSpain

ACGT

CACAAGCGAGGACCGGACCGCGTGCAAGGAATTTTATTATTCCTCACCCTCGATCCGGCTCCTCATCGGTGCCTGGGCAGTTTGTCCTGG …

Amsinckia calycina voucher Bariego PB1516(MA) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Amsinckia calycina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidypolyploid inferred

Chromosome records32–342n range33median34mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Strey 1931

CCDB · book-atlas-flowering-plants — Strey 1931

2n 342×CCDB · slov-fl · CCDB · ipcn-api-dl

CCDB · slov-fl — Perný M. & Šípošová H., 2006: Report (26), pp. 118. - In: , Chromosome number and DNA ploidy level reports from Central Europe - 2, Biologia (Bratislava) 61 /1.

CCDB · ipcn-api-dl — Friend, D. A. 1982. Chromosome number in a Victorian population of Amsinckia calycina. Austral. Weeds 1(4): 7–8.

n 171×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Friend, D. A. 1982. Chromosome number in a Victorian population of Amsinckia calycina. Austral. Weeds 1(4): 7–8.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.187 ↗

08Occurrence & distribution

Record type1 231 records

Wild obs. + sensor802

Museum / vouchered429

Origin

Native87

Introduced242

Range

Area of Occupancy AOO3 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 372≤1 km 109≤10 km 91>10 km 11

583 georeferenced · 219 without coordinates

Open the mapobservation + sensor802

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 36≤1 km 81≤10 km 102>10 km 11

230 georeferenced · 199 without coordinates

Open the institutions mapphysical evidence429

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 48 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Castelar, AR	57
Museo Entomologico de Leonlocation not on record	53
Adelaide, AU	42
Canberra, AU	33
Christchurch, NZ	32
Hobart, AU	31
Mount Annan, AU	30
UChlocation not on record	23
Chicago, US	10
San Isidro, AR	9
Brisbane, AU	9
GJOlocation not on record	7
Pretoria, ZA	7
Armidale, AU	7
Severin-McDaniel Insect Collectionlocation not on record	5
Kensington, AU	5
MAlocation not on record	4
Palmerston, AU	4
Wellington, NZ	4
Salamanca, ES	4
Saint Louis, US	4
Edinburgh, GB	3
Granada, ES	3
Valparaíso, CL	3
Córdoba, AR	3
Corrientes, AR	3
Auckland, NZ	3
Santa Barbara, US	2
Palmerston North, NZ	2
Adam Mickiewicz University in Poznańlocation not on record	2
BRNUlocation not on record	2
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	2
Canadian Department of Agriculturelocation not on record	1
Bern, CH	1
València, ES	1
PRClocation not on record	1
Museo Achille Folettolocation not on record	1
Universität Göttingenlocation not on record	1
College of the Atlantic, Museumlocation not on record	1
Cape Town, ZA	1
Provincia di Livornolocation not on record	1
Herbario Universidad de Concepciónlocation not on record	1
La Trobe Universitylocation not on record	1
Kew, GB	1
BGPAlocation not on record	1
Smithfield, AU	1
Entomological Society of Latvialocation not on record	1
Bronx, US	1

48 institutions · 424 of 429 vouchered records shown · 5 without an institution code

09Environmental DNA3 detections

Where the DNA of Amsinckia calycina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amsinckia calycina

At a glance

Sources11 archives

Size & morphology13

Life cycle & reproduction9

Diet & foraging1

Habitat & environment13

Physiology & chemistry1

Other traits1

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 231 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions30 of 48 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 231 records