Amritodus atkinsoni

(Lethierry, 1889) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Amritodus

At a glance

Occurrence records63

Data sources5

Biological traits0

DNA specimens59

eDNA detections99

Sources5 archives

Databases and archives Amritodus atkinsoni's data was compiled from.

GBIFGlobal Biodiversity Information Facility63 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI99 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics59 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF63 records

Environmental DNA1 datasets · 3 countries99 detections

DNA & barcodingBOLD59 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding59 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amritodus atkinsoni has left across the world's sequence archives.

At a glance

DNA specimens59

BINs3

Marker genes2

eDNA detections99

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Where individuals differ — all 96 variable positions, in barcode order

1Tmostly conserved

3Cmostly conserved

4Avariable

5Amostly conserved

6Tmostly conserved

7Gmostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

14Avariable

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Tmostly conserved

23Avariable

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Tmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

37Gmostly conserved

39Tmostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Cmostly conserved

46Amostly conserved

47Amostly conserved

49Gvariable

50Tvariable

51Tmostly conserved

52Amostly conserved

54Gmostly conserved

58Amostly conserved

62Amostly conserved

63Tmostly conserved

65Cmostly conserved

66Gmostly conserved

67Tvariable

68Amostly conserved

69Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tvariable

75Tmostly conserved

76Amostly conserved

77Gmostly conserved

78Cmostly conserved

79Tvariable

82Amostly conserved

85Tmostly conserved

88Amostly conserved

112Tmostly conserved

121Gmostly conserved

124Amostly conserved

127Tmostly conserved

130Amostly conserved

157Cmostly conserved

163Tmostly conserved

181Tmostly conserved

190Gmostly conserved

205Cmostly conserved

206Tmostly conserved

208Amostly conserved

220Tmostly conserved

223Tmostly conserved

232Amostly conserved

235Tmostly conserved

253Amostly conserved

256Amostly conserved

271Tvariable

274Amostly conserved

281Cmostly conserved

282Tmostly conserved

287Cmostly conserved

289Tmostly conserved

334Amostly conserved

347Cmostly conserved

349Tmostly conserved

394Cmostly conserved

397Cmostly conserved

478Tmostly conserved

487Cmostly conserved

565Tmostly conserved

578Tmostly conserved

619Cmostly conserved

631Tmostly conserved

TACAATGTATTTTATTTTTGGTATTTGATCTGGAATGGTTGGCATAATGTTAAGAATAATTATTCGTATAGAATTAGCTCAACCTGGACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.2%

Haplotypes6

BINs3

Most divergent pair2.6%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Idiocerus musteussame family11.8%Tremulicerus vitreussame family12.2%Parocerus laurifoliaesame family12.3%Idiocerus nervatussame family12.8%Tremulicerus mesopyrrhussame family12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type63 records

Wild obs. + sensor4

Museum / vouchered59

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 59 records without

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Indian Council of Agricultural Research, Research Complex for Eastern Regionlocation not on record	2
Paris, FR	2

2 institutions · 4 of 59 vouchered records shown · 18 without an institution code

09Environmental DNA99 detections

Where the DNA of Amritodus atkinsoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found99

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 99 detections have coordinates

Open the map3 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…3. Shrubland | 3.5. Subtropical/Tropical Dry…1. Forest & Woodland|1.6. Subtropical/Tropic…Mango Orchard

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.1 °C 23.4–33.4

Seasonal swing summer↔winter11.9 °C

Max temp (day)32.6 °C 27.6–37.2

Min temp (night)23.4 °C 17.8–27.9

Precipitation109 mm/mo 6.30–248

Air humidity55.6 % 47.7–66.6

Moisture balance-17.8 mm/mo -160–194

Vapour deficit1,569 Pa 1,048–2,303

Wind speed3.50 m/s 1.80–4.10

Cloud cover30.7 % 18.8–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 91 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)