Amrasca biguttula

(Ishida, 1913) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Amrasca

At a glance

Occurrence records160

Data sources8

Biological traits0

DNA specimens542

eDNA detections2 879

Sources8 archives

Databases and archives Amrasca biguttula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility160 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 879 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics542 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF160 records

Environmental DNA2 datasets · 26 countries2 879 detections

DNA & barcodingBOLD542 specimens

Genome at a glanceNCBI≈1.1 Gbp

01Narrative

Amrasca biguttula, commonly known as the cotton jassid, is a subspecies of leafhopper belonging to the subfamily Typhlocybinae of family Cicadellidae. It is a pest of cotton, okra, and other crops in southern Asia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding542 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amrasca biguttula has left across the world's sequence archives.

At a glance

DNA specimens542

BINs4

Marker genes1

eDNA detections2 879

Countries26

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P631 bp consensus535 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

2Tmostly conserved

3Cmostly conserved

4Tmostly conserved

5Gmostly conserved

7Amostly conserved

197Gmostly conserved

228Gmostly conserved

356Gmostly conserved

441Gmostly conserved

GTCTGGAATAGTAGGAATAATATTAAGTATAATCATTCGCATTGAATTAGGTCAGTTGGGTTGTTTTTTAATAAATGATCAAATATATAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 41 variants.

Diversity (π)0.96%

Haplotypes41

BINs4

Most divergent pair5.1%

AsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Matsumurasca papayaesame family16.2%Kybos virgatorsame family16.2%Hebata recurvatasame family16.3%Empoasca fabaesame family16.4%Coccineasca coccineasame family16.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Amrasca biguttula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 125 826 994 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amrasca biguttula1.13 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type160 records

Wild obs. + sensor73

Museum / vouchered87

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 29≤1 km 14≤10 km 2>10 km 6

51 georeferenced · 22 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 3≤1 km 3≤10 km 1

7 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence87

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	25
Mississippi State, US	6
National Institute for Biotechnology and Genetic Engineeringlocation not on record	3
CENTRE NATIONAL DE RECHERCHE AGRONOMIQUElocation not on record	1
DPIlocation not on record	1

5 institutions · 36 of 87 vouchered records shown · 51 without an institution code

09Environmental DNA2 879 detections

Where the DNA of Amrasca biguttula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2 879

Studies independent surveys2

Countries26

Verifiable raw sequence linked11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 879 detections have coordinates

Open the map26 countries0

8. Desert|8.1. Hot DesertSabie/Crocodile Thorn ThicketAlluvial PlainsRiparian/Oak1. Forest & Woodland | 1.6. Subtropical/Trop…Malelane??Mountain Bushveld

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 18.8–31.4

Seasonal swing summer↔winter14.8 °C

Max temp (day)30.8 °C 24.6–37.5

Min temp (night)20.1 °C 13.0–26.1

Precipitation40.0 mm/mo 4.40–163

Air humidity54.7 % 44.8–62.2

Moisture balance-78.5 mm/mo -160–20.2

Vapour deficit1,400 Pa 959–2,372

Wind speed2.50 m/s 1.60–3.80

Cloud cover22.9 % 9.80–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 614 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)