Ampullaceana balthica

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Lymnaeidae/Ampullaceana

At a glance

Occurrence records43 571

Data sources12

Biological traits0

DNA specimens1 457

eDNA detections1 695

Sources12 archives

Databases and archives Ampullaceana balthica's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility38 943 records↗

OBISOcean Biodiversity Information System4 628 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 695 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 457 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS43 571 records

Environmental DNA3 datasets · 12 countries1 695 detections

DNA & barcodingBOLD1 457 specimens

Genome at a glanceGoaT · NCBI≈1.1 Gbp

01Narrative

Radix balthica, common name the wandering snail, is a species of air-breathing freshwater snail, an aquatic pulmonate gastropod mollusk in the family Lymnaeidae, the pond snails.Neubauer, Thomas A.; Rosenberg, G.; Gofas, S. (2014). Radix balthica (Linnaeus, 1758). In: MolluscaBase (2016). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=248264 on 2017-01-10

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 457 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampullaceana balthica has left across the world's sequence archives.

At a glance

DNA specimens1 457

BINs12

Marker genes2

eDNA detections1 695

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P591 bp consensus1 187 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

2Cmostly conserved

32Gmostly conserved

62Tmostly conserved

77Tmostly conserved

80Amostly conserved

140Cmostly conserved

168Cmostly conserved

173Cvariable

182Tmostly conserved

185Tmostly conserved

191Cmostly conserved

197Tmostly conserved

245Tmostly conserved

249Tmostly conserved

254Tmostly conserved

260Tmostly conserved

263Amostly conserved

267Gmostly conserved

284Cmostly conserved

299Cmostly conserved

302Gvariable

306Cmostly conserved

317Tmostly conserved

323Cmostly conserved

362Gmostly conserved

407Cvariable

434Tmostly conserved

446Gmostly conserved

458Cmostly conserved

512Gmostly conserved

521Cmostly conserved

536Amostly conserved

575Cmostly conserved

581Amostly conserved

587Cmostly conserved

TCGGAACGGGTTTATCTTTATTAATTCGATTGGAATTAGGGACTTCGATAGTATTAATTGATGAGCATTTTTATAATGTAATTGTTACAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 40 commonest of 169 variants.

Diversity (π)2.2%

Haplotypes169

BINs11

Most divergent pair5.9%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampullaceana lagotissame genus10.3%Radix natalensissame family13.9%Galba mweruensissame family14.4%Radix auriculariasame family14.4%Radix rubiginosasame family14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ampullaceana balthica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 105 887 359 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ampullaceana balthica1.11 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type43 571 records

Wild obs. + sensor34 659

Museum / vouchered4 236

Fossil22

Other4 654

Origin

Native83

Range

Area of Occupancy AOO57 360 km²

Depth

0–200 m sunlit4 377

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.7 m · max 50 m · 4 377 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 19 164≤1 km 2 878≤10 km 10 048>10 km 12

32 102 georeferenced · 2 557 without coordinates

Open the mapobservation + sensor34 659

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 284≤1 km 27≤10 km 62>10 km 3

376 georeferenced · 3 860 without coordinates

Open the institutions mapphysical evidence4 236

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
730location not on record	1 673
TÜ_EMIlocation not on record	1 105
Gothenburg, SE	584
Philadelphia, US	277
Natural History Museum Rotterdamlocation not on record	42
SLU Artdatabankenlocation not on record	37
Institute of Zoology Slovak Academy of Scienceslocation not on record	25
Natural History Museum, Londonlocation not on record	24
Tromsø, NO	19
CBDClocation not on record	16
MZLUlocation not on record	10
Tallinn, EE	6
Musee d'Histoire Naturallelocation not on record	6
ARMS-MBONlocation not on record	2
Delaware Museum of Nature and Sciencelocation not on record	2
Paleontological Research Institutionlocation not on record	2
Museo Enrico Pirajno di Mandralisca \| Enrico Pirajno di Mandralisca Museumlocation not on record	2
RWSlocation not on record	1
Chongqing Museumlocation not on record	1
Johanna Bergkvistlocation not on record	1
South Kensington, GB	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Denver, US	1

23 institutions · 3 838 of 4 236 vouchered records shown · 317 without an institution code

09Environmental DNA1 695 detections

Where the DNA of Ampullaceana balthica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 695

Studies independent surveys3

Countries12

Verifiable raw sequence linked18

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 695 detections have coordinates

Open the map12 countries0

Marine Protected Area; Long-Term Ecological …spring waters

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C -2.50–14.7

Seasonal swing summer↔winter16.6 °C

Max temp (day)15.2 °C 0.9–18.4

Min temp (night)7.00 °C -7.30–10.4

Precipitation76.1 mm/mo 58.8–158

Air humidity60.4 % 57.5–67.9

Moisture balance6.40 mm/mo -41.0–118

Vapour deficit573 Pa 215–765

Wind speed4.00 m/s 2.70–7.00

Cloud cover45.0 % 41.6–62.4

CHELSA 1981–2010, ~9 km grid, at location & month of 713 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ampullaceana balthica

At a glance

Sources12 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type43 571 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type43 571 records