Amplicephalus littoralis

(Ball, 1905) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Amplicephalus

At a glance

Occurrence records44

Data sources5

Biological traits0

DNA specimens3

eDNA detections3

Sources5 archives

Databases and archives Amplicephalus littoralis's data was compiled from.

GBIFGlobal Biodiversity Information Facility44 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF44 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amplicephalus littoralis has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P664 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.50%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 4 variable positions, in barcode order

105Avariable

343Gvariable

610Gvariable

637Avariable

TACATTATATTTCATCTTTGGAATTTGGTCGGGTTTAATTGGAATAACACTTAGAATTATTATCCGGATTGAGTTAGCACAACCTAGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amplicephalus osbornisame genus16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type44 records

Museum / vouchered44

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence44

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	28
North Carolina State University Insect Museumlocation not on record	13
Champaign, US	1

3 institutions · 42 of 44 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Amplicephalus littoralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

Vegetation

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)