Ampithoe valida

S.I.Smith, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Ampithoidae/Ampithoe

At a glance

Occurrence records1 014

Data sources7

Biological traits4

DNA specimens97

eDNA detections91

Sources7 archives

Databases and archives Ampithoe valida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility456 records↗

OBISOcean Biodiversity Information System558 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI91 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics97 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS1 014 records

Environmental DNA1 datasets · 4 countries91 detections

DNA & barcodingBOLD97 specimens

01Narrative

Ampithoe valida is een vlokreeftensoort uit de familie van de Ampithoidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1873 door Smith.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max30 m

Depth min0 m

05DNA & barcoding97 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampithoe valida has left across the world's sequence archives.

At a glance

DNA specimens97

BINs4

Marker genes3

eDNA detections91

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P508 bp consensus82 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

23Tmostly conserved

38Avariable

92Cvariable

96Tmostly conserved

102Tvariable

107Gvariable

119Avariable

128Gmostly conserved

134Avariable

137Tmostly conserved

161Ghighly variable

191Amostly conserved

194Amostly conserved

206Gmostly conserved

212Tvariable

218Tvariable

242Amostly conserved

248Amostly conserved

251Cvariable

257Tvariable

266Tvariable

281Amostly conserved

293Cvariable

341Cvariable

356Amostly conserved

371Amostly conserved

404Cmostly conserved

410Tmostly conserved

416Avariable

428Avariable

429Tvariable

431Avariable

452Gmostly conserved

473Avariable

479Tvariable

485Cvariable

TTTACAACACCATCGTAACAGCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCTATTATAATCGGTGGCTTCGGAAATTGATTGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 44 variants.

Diversity (π)3.1%

Haplotypes44

BINs4

Most divergent pair5.3%

N.AmericaAsiaOther

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCYTB

animal barcoderibosomalmitochondrial

08Occurrence & distribution

Record type1 014 records

Wild obs. + sensor434

Museum / vouchered564

Other16

Origin

Native1

Range

Area of Occupancy AOO1 520 km²

Depth

0–200 m sunlit64

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.6 m · max 37 m · 64 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 10≤1 km 2≤10 km 1

13 georeferenced · 421 without coordinates

Open the mapobservation + sensor434

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 2≤1 km 33≤10 km 57>10 km 6

98 georeferenced · 466 without coordinates

Open the institutions mapphysical evidence564

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	59
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	40
Buenos Aires, AR	24
Washington, US	23
CASlocation not on record	21
Paris, FR	16
National Institute of Biological Resourceslocation not on record	16
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
IBIOMARlocation not on record	11
Victoria, CA	6
Sam Noble Oklahoma Museum of Natural Historylocation not on record	6
University of British Columbia, Beaty Biodiversity Museumlocation not on record	5
Institut Francais pour l'Etude de la Merlocation not on record	4
Universidad Simón Bolívarlocation not on record	4
Edmonton, CA	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	1
Hakai Institutelocation not on record	1
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	1
Los Angeles, US	1
Texas Cooperative Wildlife Collectionlocation not on record	1

22 institutions · 258 of 564 vouchered records shown · 29 without an institution code

09Environmental DNA91 detections

Where the DNA of Ampithoe valida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found91

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 91 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 11.5–20.9

Seasonal swing summer↔winter21.3 °C

Max temp (day)19.4 °C 15.2–23.3

Min temp (night)15.5 °C 7.40–18.9

Precipitation87.3 mm/mo 82.7–138

Air humidity60.3 % 58.0–63.1

Moisture balance-60.4 mm/mo -62.6–94.0

Vapour deficit775 Pa 501–986

Wind speed3.70 m/s 1.70–5.40

Cloud cover44.1 % 34.3–44.4

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ampithoe valida

At a glance

Sources7 archives

Habitat & environment2

Other traits2

At a glance

Record type1 014 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 014 records