Ampithoe sectimana

Conlan & Bousfield, 1982 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Ampithoidae/Ampithoe

At a glance

Occurrence records75

Data sources7

Biological traits1

DNA specimens5

eDNA detections6

Sources7 archives

Databases and archives Ampithoe sectimana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility63 records↗

OBISOcean Biodiversity Information System12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS75 records

Environmental DNA2 datasets · 2 countries6 detections

DNA & barcodingBOLD5 specimens

01Narrative

Ampithoe sectimana is een vlokreeftensoort uit de familie van de Ampithoidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1982 door Conlan & Bousfield.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampithoe sectimana has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Where individuals differ — all 119 variable positions, in barcode order

1Avariable

4Cvariable

7Cvariable

11Tvariable

13Avariable

16Gvariable

19Avariable

22Gvariable

25Cvariable

28Gvariable

29Avariable

30Tvariable

32Gvariable

43Cvariable

44Tvariable

46Gvariable

49Avariable

70Gvariable

73Avariable

79Tvariable

82Tvariable

85Cvariable

86Tvariable

88Avariable

100Cvariable

109Tmostly conserved

112Cmostly conserved

115Amostly conserved

118Cmostly conserved

127Tmostly conserved

133Amostly conserved

148Cmostly conserved

157Cmostly conserved

175Tmostly conserved

181Tmostly conserved

184Gmostly conserved

187Tmostly conserved

191Cmostly conserved

193Gmostly conserved

194Gmostly conserved

202Amostly conserved

206Tmostly conserved

208Amostly conserved

214Amostly conserved

217Amostly conserved

223Amostly conserved

226Cmostly conserved

229Cmostly conserved

232Gmostly conserved

235Amostly conserved

244Tvariable

271Cmostly conserved

272Tmostly conserved

274Amostly conserved

275Amostly conserved

280Amostly conserved

281Tmostly conserved

283Amostly conserved

292Amostly conserved

295Tmostly conserved

301Tmostly conserved

304Amostly conserved

307Amostly conserved

313Tmostly conserved

322Gmostly conserved

328Tmostly conserved

334Cmostly conserved

346Amostly conserved

349Gmostly conserved

358Cmostly conserved

367Tvariable

370Amostly conserved

373Tmostly conserved

376Amostly conserved

385Amostly conserved

391Cmostly conserved

394Amostly conserved

397Amostly conserved

400Cmostly conserved

401Cmostly conserved

403Tmostly conserved

406Cmostly conserved

409Tmostly conserved

415Gmostly conserved

418Amostly conserved

422Cmostly conserved

424Tmostly conserved

427Tmostly conserved

442Tmostly conserved

445Cmostly conserved

448Tmostly conserved

451Amostly conserved

469Cmostly conserved

472Cmostly conserved

487Amostly conserved

490Cmostly conserved

508Tmostly conserved

511Tmostly conserved

535Gmostly conserved

538Amostly conserved

550Tmostly conserved

559Amostly conserved

568Amostly conserved

575Cmostly conserved

589Tmostly conserved

590Cmostly conserved

592Tmostly conserved

595Tmostly conserved

604Cmostly conserved

607Cmostly conserved

610Cmostly conserved

613Tvariable

619Gvariable

622Gvariable

625Tvariable

631Avariable

634Tvariable

643Avariable

647Tvariable

ATACTTCATTTTAGGGGGATGGGCCGGGATAGTAGGGGCCTCCTTGAGAATAATTATTCGAACTGAGTTGAGAACCCCTGGTAACTTAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)8.7%

Haplotypes3

BINs2

Most divergent pair18.3%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type75 records

Wild obs. + sensor4

Museum / vouchered68

Other3

Range

Area of Occupancy AOO204 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0.1 m · max 0.8 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	50
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Washington, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Stanford Universitylocation not on record	1
Los Angeles, US	1

6 institutions · 59 of 68 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Ampithoe sectimana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 11.0–13.0

Seasonal swing summer↔winter9.20 °C

Max temp (day)14.9 °C 13.4–17.7

Min temp (night)8.50 °C 8.30–11.1

Precipitation130 mm/mo 89.8–136

Air humidity63.7 % 58.6–66.0

Moisture balance9.10 mm/mo -28.9–54.7

Vapour deficit506 Pa 473–688

Wind speed4.20 m/s 4.00–5.50

Cloud cover39.7 % 37.3–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)