Ampithoe longimana

Smith, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Ampithoidae/Ampithoe

At a glance

Occurrence records439

Data sources8

Biological traits4

DNA specimens38

eDNA detections176

Sources8 archives

Databases and archives Ampithoe longimana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility285 records↗

OBISOcean Biodiversity Information System154 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI176 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS439 records

Environmental DNA2 datasets · 2 countries176 detections

DNA & barcodingBOLD38 specimens

01Narrative

Ampithoe longimana is een vlokreeftensoort uit de familie van de Ampithoidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1873 door Smith.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max10 m

Depth min0 m

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampithoe longimana has left across the world's sequence archives.

At a glance

DNA specimens38

BINs4

Marker genes3

eDNA detections176

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Where individuals differ — all 104 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

4Amostly conserved

5Cmostly conserved

6Tmostly conserved

7Tmostly conserved

9Amostly conserved

10Tvariable

11Tmostly conserved

14Amostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Amostly conserved

22Gmostly conserved

23Gmostly conserved

25Tmostly conserved

26Tmostly conserved

27Gmostly conserved

28Amostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

34Tvariable

35Amostly conserved

37Amostly conserved

39Tmostly conserved

40Cvariable

42Gmostly conserved

43Amostly conserved

44Gmostly conserved

46Tmostly conserved

48Cmostly conserved

49Cmostly conserved

50Tmostly conserved

51Tmostly conserved

54Gmostly conserved

56Avariable

58Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Cmostly conserved

70Amostly conserved

71Gmostly conserved

72Amostly conserved

73Avariable

74Tmostly conserved

75Tmostly conserved

77Amostly conserved

78Gmostly conserved

79Amostly conserved

80Tmostly conserved

82Amostly conserved

83Cmostly conserved

84Cmostly conserved

85Cmostly conserved

86Gmostly conserved

87Gmostly conserved

88Amostly conserved

89Amostly conserved

90Amostly conserved

92Cmostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

99Gmostly conserved

100Amostly conserved

103Tmostly conserved

109Gvariable

115Tmostly conserved

169Amostly conserved

196Amostly conserved

206Tmostly conserved

220Avariable

226Tvariable

235Cvariable

247Cmostly conserved

253Gmostly conserved

286Amostly conserved

322Cmostly conserved

331Gvariable

349Amostly conserved

361Avariable

421Amostly conserved

433Tmostly conserved

442Tvariable

536Cvariable

538Amostly conserved

539Cvariable

542Cmostly conserved

544Amostly conserved

550Amostly conserved

562Gvariable

580Amostly conserved

581Tmostly conserved

618Cmostly conserved

619Gvariable

622Amostly conserved

628Gvariable

634Tmostly conserved

AACACTTTATTTTATTTTAGGGGGTTGAGCTGGTATAGTCGGAGCTTCCTTAAGAATAATTATTCGAACAGAATTAAGATCACCCGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.9%

Haplotypes5

BINs4

Most divergent pair4.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampithoe ramondisame genus14.3%Ampithoe plumulosasame genus15.0%Pleonexes hellerisame family15.0%Sunamphitoe giganteasame family17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCYTB

animal barcoderibosomalmitochondrial

08Occurrence & distribution

Record type439 records

Wild obs. + sensor111

Museum / vouchered325

Other3

Range

Area of Occupancy AOO672 km²

Depth

0–200 m sunlit88

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2 m · max 38 m · 88 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 26

26 georeferenced · 85 without coordinates

Open the mapobservation + sensor111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 9≤1 km 42≤10 km 15>10 km 37

103 georeferenced · 222 without coordinates

Open the institutions mapphysical evidence325

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	93
Washington, US	38
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	32
Universidad Simón Bolívarlocation not on record	21
Mexico City, MX	13
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	10
Maurice Lamontagne Institutelocation not on record	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Los Angeles, US	3
Cambridge, US	2
	1
Saint John, CA	1

12 institutions · 224 of 325 vouchered records shown · 34 without an institution code

09Environmental DNA176 detections

Where the DNA of Ampithoe longimana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found176

Studies independent surveys2

Countries2

Verifiable raw sequence linked138

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 176 detections have coordinates

Open the map2 countries0

Estuary

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C -7.30–18.8

Seasonal swing summer↔winter25.9 °C

Max temp (day)20.4 °C -3.50–21.9

Min temp (night)16.9 °C -10.5–17.2

Precipitation96.6 mm/mo 88.1–105

Air humidity62.2 % 61.0–64.0

Moisture balance-25.2 mm/mo

Vapour deficit810 Pa 131–840

Wind speed4.70 m/s

Cloud cover52.2 % 46.6–59.6

CHELSA 1981–2010, ~9 km grid, at location & month of 145 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)