Ampithoe dalli

Shoemaker, 1938 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Ampithoidae/Ampithoe

At a glance

Occurrence records273

Data sources7

Biological traits2

DNA specimens29

eDNA detections29

Sources7 archives

Databases and archives Ampithoe dalli's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility220 records↗

OBISOcean Biodiversity Information System53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS273 records

Environmental DNA2 datasets · 2 countries29 detections

DNA & barcodingBOLD29 specimens

01Narrative

Ampithoe dalli is een vlokreeftensoort uit de familie van de Ampithoidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1938 door Clarence Raymond Shoemaker.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampithoe dalli has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes2

eDNA detections29

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P614 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 80 variable positions, in barcode order

5Tmostly conserved

73Amostly conserved

74Tmostly conserved

80Gmostly conserved

100Gmostly conserved

115Tmostly conserved

121Amostly conserved

133Gmostly conserved

163Amostly conserved

181Tmostly conserved

190Gmostly conserved

217Tmostly conserved

220Amostly conserved

223Amostly conserved

229Amostly conserved

235Tmostly conserved

238Amostly conserved

262Gmostly conserved

263Tmostly conserved

266Cmostly conserved

283Tmostly conserved

287Cmostly conserved

289Tmostly conserved

290Cmostly conserved

292Tmostly conserved

302Amostly conserved

307Amostly conserved

316Gmostly conserved

319Amostly conserved

322Amostly conserved

328Tmostly conserved

334Tmostly conserved

337Tmostly conserved

340Cmostly conserved

343Cmostly conserved

352Gmostly conserved

355Gmostly conserved

358Amostly conserved

373Tmostly conserved

376Tmostly conserved

379Amostly conserved

382Amostly conserved

385Cmostly conserved

386Cmostly conserved

391Amostly conserved

406Cmostly conserved

407Cmostly conserved

409Tmostly conserved

412Amostly conserved

421Gmostly conserved

442Tmostly conserved

454Amostly conserved

457Gmostly conserved

458Cmostly conserved

469Tmostly conserved

470Gmostly conserved

490Tvariable

496Tmostly conserved

500Tmostly conserved

502Amostly conserved

511Amostly conserved

517Amostly conserved

526Cmostly conserved

532Cmostly conserved

533Cmostly conserved

535Gmostly conserved

536Cmostly conserved

538Tmostly conserved

541Amostly conserved

548Cmostly conserved

550Cmostly conserved

557Cmostly conserved

559Tmostly conserved

562Amostly conserved

565Amostly conserved

568Amostly conserved

574Tmostly conserved

586Tmostly conserved

592Tmostly conserved

604Tmostly conserved

AACATTATATTTTATCCTGGGAGGGTGAGCTGGAATAACAGGAGCTTCCTTGAGGATAATTATCCGAACAGAATTAAGAGGGCCTGGTAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes7

BINs2

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pleonexes hellerisame family14.2%Ampithoe lacertosasame genus15.8%Ampithoe ramondisame genus16.1%Aoroides longimerussame order16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type273 records

Wild obs. + sensor20

Museum / vouchered236

Other17

Range

Area of Occupancy AOO576 km²

Depth

0–200 m sunlit29

200–1000 m twilight0

1–4 km midnight1

>4 km abyssal0

median 0 m · max 1 601 m · 30 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 30

30 georeferenced · 206 without coordinates

Open the institutions mapphysical evidence236

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	128
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	18
Los Angeles, US	15
Victoria, CA	11
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Florida Museum of Natural Historylocation not on record	3
Washington, US	3
Edmonton, CA	3
Stanford Universitylocation not on record	1

9 institutions · 187 of 236 vouchered records shown · 15 without an institution code

09Environmental DNA29 detections

Where the DNA of Ampithoe dalli was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

Marinerocky benchlow to mid intertidal boulder fieldRock Scarp/WallRock Outcrop

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 7.10–14.5

Seasonal swing summer↔winter10.4 °C

Max temp (day)15.6 °C 9.60–17.2

Min temp (night)9.50 °C 4.80–12.5

Precipitation143 mm/mo 113–228

Air humidity64.8 % 61.6–69.6

Moisture balance44.0 mm/mo -0.2–128

Vapour deficit501 Pa 388–538

Wind speed3.40 m/s 2.70–4.70

Cloud cover38.6 % 36.7–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)