Amphotis marginata

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Nitidulidae/Amphotis

At a glance

Occurrence records1 112

Data sources7

Biological traits1

DNA specimens21

eDNA detections23

Sources7 archives

Databases and archives Amphotis marginata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 112 records

Environmental DNA2 datasets · 4 countries23 detections

DNA & barcodingBOLD21 specimens

01Narrative

Amphotis marginata is a nitidulid beetle.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)omnivore

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphotis marginata has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes2

eDNA detections23

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 3 variable positions, in barcode order

499Amostly conserved

583Gmostly conserved

631Tmostly conserved

AACCCTCTATTTCATTTTTGGGGCTTGATCAAGAATAGTTGGAACCTCTTTAAGAATACTAATTCGTACTGAATTAGGATCACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Heterhelus scutellarissame order14.1%Carpophilus obsoletussame family14.5%Tachinus marginellussame order14.6%Ochthebius japonicussame order14.9%Heliconius ethillasame order16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type1 112 records

Wild obs. + sensor787

Museum / vouchered219

Other106

Range

Area of Occupancy AOO2 728 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 233≤1 km 115≤10 km 250>10 km 9

607 georeferenced · 180 without coordinates

Open the mapobservation + sensor787

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy70% within 1 km

≤100 m 36≤1 km 71≤10 km 43>10 km 2

152 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	83
Muzeum Górnośląskie w Bytomiulocation not on record	20
Provincia di Livornolocation not on record	15
MZLUlocation not on record	9
Uniwersytet Wrocławskilocation not on record	9
ZSMlocation not on record	8
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	5
Natural History Museum Rotterdamlocation not on record	5
Tilburg, NL	4
Adam Mickiewicz University in Poznańlocation not on record	4
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	2
NMOKlocation not on record	2
NCMGlocation not on record	2
Salzburg, AT	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Helsinki, FI	1
Vitoria, ES	1
LSMlocation not on record	1

18 institutions · 173 of 219 vouchered records shown · 46 without an institution code

09Environmental DNA23 detections

Where the DNA of Amphotis marginata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys2

Countries4

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map4 countries0

HofgelÃ¤ndein einer Lichtfalle

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 15.2–18.2

Seasonal swing summer↔winter18.1 °C

Max temp (day)21.1 °C 19.0–22.7

Min temp (night)12.9 °C 10.6–13.8

Precipitation73.3 mm/mo 61.6–93.8

Air humidity59.3 % 58.1–61.3

Moisture balance-46.5 mm/mo -65.8–-23.6

Vapour deficit801 Pa 668–876

Wind speed3.30 m/s 2.30–3.70

Cloud cover35.0 % 29.8–38.5

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphotis marginata

At a glance

Sources7 archives

Diet & foraging1

At a glance

Record type1 112 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 112 records