Amphorina andra

Korshunova, Malmberg, Prkić, Petani, Fletcher, Lundin & Martynov, 2020 · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Nudibranchia/Eubranchidae/Amphorina

At a glance

Occurrence records77

Data sources4

Biological traits1

DNA specimens9

eDNA detections0

Sources4 archives

Databases and archives Amphorina andra's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility77 records↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF77 records

DNA & barcodingBOLD9 specimens

01Narrative

Amphorina andra is a species of sea slug or nudibranch, a marine gastropod mollusc in the family Eubranchidae.MolluscaBase eds. (2020). MolluscaBase. Amphorina andra Korshunova, Malmberg, Prkic, Petani, Fletcher, Lundin, Martynov, 2020. Accessed on 2020-04-04.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphorina andra has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.68%

Haplotypes2

BIN1

Most divergent pair0.76%

Where individuals differ — all 12 variable positions, in barcode order

31Cvariable

124Cmostly conserved

206Cvariable

286Amostly conserved

343Amostly conserved

349Tmostly conserved

445Cmostly conserved

463Cmostly conserved

493Avariable

518Tmostly conserved

542Tvariable

619Gmostly conserved

AACTCTCTATGTCTTATTAGGGATGTGATGCGGTCTAGTGGGAACTGGACTTAGACTTTTAATTCGATTCGAGTTAGGTACTGCGGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphorina linensissame genus11.9%Eubranchus tricolorsame family14.8%Cuthona pallidasame order15.4%Eubranchus horiisame family15.6%Cuthonella hiemalissame order15.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type77 records

Wild obs. + sensor60

Museum / vouchered17

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 15≤1 km 11≤10 km 12

38 georeferenced · 22 without coordinates

Open the mapobservation + sensor60

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 5

14 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	9
Bergen, NO	5
Museo Nacional de Ciencias Naturales (CSIC)location not on record	2
University of Barcelona, Department of Evolutionary Biology, Ecology and Environmental Scienceslocation not on record	1

4 institutions · 17 of 17 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)