Amphiura chiajei
Forbes, 1843 · speciesAt a glance
Occurrence records44 817
Data sources8
Biological traits4
DNA specimens28
eDNA detections69
Sources8 archives
Databases and archives Amphiura chiajei's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility26 462 records↗
OBISOcean Biodiversity Information System18 355 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI69 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics28 specimens↗
Open Tree of LifeOpenTreephylogeny backbone↗
Catalogue of LifeCOLtaxonomy↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources4 traits
Occurrence & distributionGBIF · OBIS44 817 records
Environmental DNA6 datasets · 3 countries69 detections
DNA & barcodingBOLD28 specimens
01Narrative
Amphiura chiajei is a species of brittle star belonging to the family Amphiuridae. It is found in the northeastern Atlantic Ocean and adjoining seas to a depth of 1000 m. It digs itself into the soft sediment of the seabed and raises its arms into the water above to suspension feed on plankton. It was first described by the British naturalist Edward Forbes in 1843, and was named for the Italian zoologist Stefano Delle Chiaje (1794–1860).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesSeaLifeBase
Habitat & environment2
Habitat saltwateryes
Habitat zonebenthic
Other traits2
Depth max1 200 m
Depth min2 m
05DNA & barcoding28 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphiura chiajei has left across the world's sequence archives.
At a glance
DNA specimens28
BINs6
Marker genes2
eDNA detections69
Countries4
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P658 bp consensus21 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.
Where individuals differ — all 138 variable positions, in barcode order
4Cvariable
10Tmostly conserved
13Cmostly conserved
16Amostly conserved
19Tmostly conserved
22Avariable
25Chighly variable
28Gmostly conserved
31Cvariable
34Amostly conserved
37Cmostly conserved
40Avariable
43Cvariable
49Tmostly conserved
55Avariable
61Avariable
64Cvariable
70Cvariable
73Avariable
76Cmostly conserved
79Tmostly conserved
82Avariable
85Cvariable
91Amostly conserved
94Tmostly conserved
97Amostly conserved
103Cmostly conserved
115Tmostly conserved
118Cmostly conserved
121Cmostly conserved
127Tmostly conserved
130Amostly conserved
133Amostly conserved
145Avariable
151Cmostly conserved
154Cmostly conserved
157Tmostly conserved
163Amostly conserved
169Amostly conserved
172Cmostly conserved
181Amostly conserved
184Tmostly conserved
187Cvariable
190Tvariable
193Amostly conserved
196Avariable
199Avariable
202Amostly conserved
205Cvariable
206Tvariable
214Avariable
217Gvariable
220Cvariable
226Tmostly conserved
232Cmostly conserved
235Cvariable
238Cmostly conserved
241Amostly conserved
247Amostly conserved
250Tvariable
256Amostly conserved
259Cvariable
268Amostly conserved
271Cmostly conserved
274Cvariable
292Avariable
298Cmostly conserved
301Cvariable
316Amostly conserved
319Cvariable
322Cmostly conserved
328Avariable
337Cvariable
352Amostly conserved
355Avariable
367Cmostly conserved
370Avariable
373Amostly conserved
376Avariable
379Cvariable
382Cvariable
388Avariable
391Tmostly conserved
394Tmostly conserved
400Tvariable
403Tmostly conserved
406Tmostly conserved
407Tmostly conserved
412Avariable
415Avariable
418Cvariable
421Amostly conserved
433Tvariable
436Cvariable
439Tmostly conserved
442Tmostly conserved
448Cvariable
451Tvariable
457Tmostly conserved
460Tmostly conserved
469Amostly conserved
472Amostly conserved
475Avariable
478Tvariable
484Amostly conserved
493Cvariable
499Amostly conserved
517Cvariable
520Cvariable
521Cvariable
523Avariable
526Tmostly conserved
533Tmostly conserved
535Amostly conserved
538Tvariable
541Tmostly conserved
542Cvariable
544Amostly conserved
550Amostly conserved
556Cvariable
+18 more variable positions not shown
AACCCTTTATTTCATATTTGGAGCCTGGGCCGGAACCGTAGGCACCGCTATGAGAAAAATAATCCGAGTCGAACTCTCTCAACCCGGATC …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)8.6%
Haplotypes12
BINs6
Most divergent pair17.3%
EuropeOther
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P18S-3P
animal barcoderibosomal
08Occurrence & distribution
Record type44 817 records
Wild obs. + sensor18 144
Museum / vouchered19 216
Other7 457
Origin
Native250
Range
Area of Occupancy AOO21 136 km²
Depth
0–200 m sunlit11 229
200–1000 m twilight260
1–4 km midnight0
>4 km abyssal0
median 90.8 m · max 652 m · 11 489 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy99% within 1 km
≤100 m 15 634≤1 km 595≤10 km 77>10 km 10
16 316 georeferenced · 1 828 without coordinates
Open the mapobservation + sensor18 144
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy80% within 1 km
≤100 m 454≤1 km 627≤10 km 261>10 km 7
1 349 georeferenced · 17 867 without coordinates
Open the institutions mapphysical evidence19 216
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions14 of 53 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| 730location not on record | 1 679 |
| CEFASlocation not on record | 854 |
| Bergen, NO | 493 |
| Stockholm, SE | 493 |
| Gothenburg, SE | 330 |
| NTNU-VMlocation not on record | 319 |
| MZLUlocation not on record | 307 |
| SLU Artdatabankenlocation not on record | 299 |
| RWSlocation not on record | 126 |
| DASSHlocation not on record | 125 |
| Laboratoria di biologia marina di Triestelocation not on record | 97 |
| Institut Francais pour l'Etude de la Merlocation not on record | 90 |
| 486location not on record | 69 |
| Observatoire Océanologique de Banyuls-Sur-Mer; Laboratoire d'Océanographie Biologiquelocation not on record | 56 |
| Stockholm, SE | 53 |
| Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record | 48 |
| South Kensington, GB | 20 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 16 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record | 15 |
| Johanna Bergkvistlocation not on record | 13 |
| 630location not on record | 12 |
| Frankfurt am Main | 10 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507)location not on record | 8 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 8 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 7 |
| Biomorlocation not on record | 7 |
| Natural History Museum, Londonlocation not on record | 6 |
| Université de Liège Underwater research and oceanographic station (4501)location not on record | 6 |
| Istituto di Scienze Marine di Venezialocation not on record | 5 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record | 4 |
| Norwegian Institute of Marine Researchlocation not on record | 4 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 4 |
| Washington, US | 4 |
| Turkmen Agricultural University named after S.A. Niyazovlocation not on record | 4 |
| Brussels, BE | 4 |
| Helsinki, FI | 3 |
| University of Oslo (UiO)location not on record | 3 |
| BioFokuslocation not on record | 3 |
| Cambridge, US | 3 |
| ARMS-MBONlocation not on record | 2 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393)location not on record | 2 |
| Montgomery, US | 2 |
| Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record | 2 |
| HCMRlocation not on record | 2 |
| RBINS-Scientific Heritagelocation not on record | 2 |
| PNHSlocation not on record | 2 |
| Los Angeles, US | 1 |
| CASlocation not on record | 1 |
| Bergen, NO | 1 |
| Phaxas Expertise Of Marine Fauna (4507)location not on record | 1 |
| Laboratorio di Ecologia del Benthos | Benthos Ecology Laboratorylocation not on record | 1 |
| HCMR-IMBBClocation not on record | 1 |
| Tromsø, NO | 1 |
53 institutions · 5 628 of 19 216 vouchered records shown · 5 170 without an institution code
09Environmental DNA69 detections
Where the DNA of Amphiura chiajei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found69
Studies independent surveys6
Countries3
Verifiable raw sequence linked59
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 69 detections have coordinates
Open the map3 countries0
Research site; semi-industrial; 9.5 - Subtid…Long-Term Ecological Research Site; LHI (Low…Soft mud
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.4 °C 8.70–16.7
Seasonal swing summer↔winter17.0 °C
Max temp (day)14.6 °C 10.6–19.5
Min temp (night)8.10 °C 6.70–15.2
Precipitation82.8 mm/mo 54.1–100
Air humidity62.5 % 58.7–65.2
Moisture balance8.00 mm/mo
Vapour deficit558 Pa 389–721
Wind speed5.10 m/s
Cloud cover50.1 % 46.2–53.9
CHELSA 1981–2010, ~9 km grid, at location & month of 68 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.