Amphitritides gracilis

(Grube, 1860) · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Terebellidae/Amphitritides

At a glance

Occurrence records1 850

Data sources7

Biological traits2

DNA specimens12

eDNA detections8

Sources7 archives

Databases and archives Amphitritides gracilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility933 records↗

OBISOcean Biodiversity Information System917 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 850 records

Environmental DNA3 datasets · 2 countries8 detections

DNA & barcodingBOLD12 specimens

01Narrative

Amphitritides gracilis is een borstelworm uit de familie Terebellidae. Het lichaam van de worm bestaat uit een kop, een cilindrisch, gesegmenteerd lichaam en een staartstukje. De kop bestaat uit een prostomium en een peristomium en draagt gepaarde aanhangsels. Amphitritides gracilis werd in 1860 voor het eerst wetenschappelijk beschreven door Grube.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphitritides gracilis has left across the world's sequence archives.

At a glance

DNA specimens12

BINs3

Marker genes3

eDNA detections8

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Diversity (π)3.4%

Haplotypes1

BINs2

Where individuals differ — all 67 variable positions, in barcode order

13Tmostly conserved

34Amostly conserved

58Amostly conserved

64Cmostly conserved

100Tmostly conserved

103Gmostly conserved

112Amostly conserved

136Cmostly conserved

163Amostly conserved

173Cmostly conserved

175Gmostly conserved

181Gmostly conserved

184Gmostly conserved

193Cmostly conserved

202Cmostly conserved

206Tmostly conserved

217Amostly conserved

229Gmostly conserved

250Cmostly conserved

271Gmostly conserved

283Amostly conserved

298Amostly conserved

316Gmostly conserved

318Cmostly conserved

319Gmostly conserved

322Gmostly conserved

343Cmostly conserved

346Tmostly conserved

349Tmostly conserved

361Gmostly conserved

364Cmostly conserved

367Tmostly conserved

370Amostly conserved

386Cmostly conserved

388Amostly conserved

412Tmostly conserved

415Gmostly conserved

421Gmostly conserved

433Tmostly conserved

457Gmostly conserved

460Tmostly conserved

478Cmostly conserved

484Tmostly conserved

499Cmostly conserved

511Amostly conserved

520Tmostly conserved

529Gmostly conserved

536Tmostly conserved

550Amostly conserved

553Cmostly conserved

557Tmostly conserved

559Amostly conserved

568Tmostly conserved

571Cmostly conserved

577Gmostly conserved

580Tmostly conserved

583Amostly conserved

604Cmostly conserved

607Amostly conserved

619Tmostly conserved

620Gmostly conserved

622Amostly conserved

628Gmostly conserved

631Amostly conserved

637Amostly conserved

638Gmostly conserved

653Tmostly conserved

AACACTATATTTTATTCTAGGAGTCTGAGGCGGACTCTTAGGCACTTCTATAAGAATATTAATCCGTGTAGAACTAGGCCAACCCGGCTC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 850 records

Wild obs. + sensor490

Museum / vouchered1 225

Other135

Range

Area of Occupancy AOO2 164 km²

Depth

0–200 m sunlit678

200–1000 m twilight5

1–4 km midnight0

>4 km abyssal0

median 40.2 m · max 337 m · 683 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 262≤1 km 1≤10 km 3

266 georeferenced · 224 without coordinates

Open the mapobservation + sensor490

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 51≤1 km 10≤10 km 10>10 km 11

82 georeferenced · 1 143 without coordinates

Open the institutions mapphysical evidence1 225

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEFASlocation not on record	401
DASSHlocation not on record	39
Institut Francais pour l'Etude de la Merlocation not on record	18
486location not on record	15
PNHSlocation not on record	15
730location not on record	3
HCMR - IMBBClocation not on record	2
Biomorlocation not on record	2
HCMRlocation not on record	2
Natural History Museum, Londonlocation not on record	2
South Kensington, GB	2
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record	1
Station Biologique de Roscoff (EDMO:521)location not on record	1
Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record	1
CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Université de Liège Underwater research and oceanographic station (4501)location not on record	1
Stockholm, SE	1
Bulgarian Academy of Sciences, Institute of Biodiversity and Ecosystem Researchlocation not on record	1
Natural History Museum of the Iberian Peninsula - NatMIP ("Museu de História Natural da Península Ibérica")location not on record	1

18 institutions · 508 of 1 225 vouchered records shown · 26 without an institution code

09Environmental DNA8 detections

Where the DNA of Amphitritides gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys3

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

Mexico, Gulf of

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature25.7 °C 20.1–27.3

Conductivity53,715 µS/cm 48,732–53,715

Salinity35.4 PSU 34.9–35.6

Dissolved oxygen6.70 mg/L

Turbidity0.359 NTU

Nitrate0.2 µmol/L 0.1–1.70

Depth10.0 m 2.00–46.0

Coastal waterPelagic

6 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 22.9–26.1

Seasonal swing summer↔winter6.40 °C

Max temp (day)24.2 °C 24.2–28.2

Min temp (night)22.2 °C 21.3–24.1

Precipitation96.2 mm/mo 6.60–130

Air humidity59.7 % 55.7–60.5

Vapour deficit1,162 Pa 1,156–1,456

Cloud cover28.0 % 23.4–32.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphitritides gracilis

At a glance

Sources7 archives

Habitat & environment2

At a glance

Record type1 850 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 850 records