Amphitrite figulus

(Dalyell, 1853) · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Terebellidae/Amphitrite

At a glance

Occurrence records3 148

Data sources6

Biological traits2

DNA specimens6

eDNA detections235

Sources6 archives

Databases and archives Amphitrite figulus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility90 records↗

OBISOcean Biodiversity Information System3 058 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI235 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS3 148 records

Environmental DNA5 datasets · 6 countries235 detections

DNA & barcodingBOLD6 specimens

01Narrative

Amphitrite figulus is een borstelworm uit de familie Terebellidae. Het lichaam van de worm bestaat uit een kop, een cilindrisch, gesegmenteerd lichaam en een staartstukje. De kop bestaat uit een prostomium en een peristomium en draagt gepaarde aanhangsels. Amphitrite figulus werd voor het eerst wetenschappelijk beschreven door Dalyell).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphitrite figulus has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes2

eDNA detections235

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P571 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

GGAATCTGAGGAGGGTTATTAGGAACCTCTATAAGATTACTAATCCGAATCGAATTAGGACAGCCCGGAGCTTTCCTTGGGAGAGACCAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neoamphitrite groenlandicasame family10.0%Neoamphitrite grayisame family15.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type3 148 records

Wild obs. + sensor150

Museum / vouchered616

Other2 382

Range

Area of Occupancy AOO2 804 km²

Depth

0–200 m sunlit1 601

200–1000 m twilight17

1–4 km midnight0

>4 km abyssal0

median 6.3 m · max 500 m · 1 618 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 65≤1 km 31

96 georeferenced · 54 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 4≤1 km 26≤10 km 3

33 georeferenced · 583 without coordinates

Open the institutions mapphysical evidence616

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	21
Bergen, NO	13
ARMS-MBONlocation not on record	8
Washington, US	7
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	6
The Atlantic reference Centrelocation not on record	3
Cambridge, US	1
Norwegian Institute of Marine Researchlocation not on record	1
Paris, FR	1
Sydney, AU	1
CEFASlocation not on record	1

11 institutions · 63 of 616 vouchered records shown · 18 without an institution code

09Environmental DNA235 detections

Where the DNA of Amphitrite figulus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found235

Studies independent surveys5

Countries6

Verifiable raw sequence linked163

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 235 detections have coordinates

Open the map6 countries0

intertidal: mud flat with boulders and seawe…Marine Protected Area; protected; 9.5 - Subt…Marine Protected Area; protected; 9.2 - Subt…Marina; semi-industrial; 9.5 - Subtidal Sand…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.90 °C -5.30–17.2

Seasonal swing summer↔winter23.4 °C

Max temp (day)13.0 °C -1.40–21.1

Min temp (night)7.00 °C -8.90–14.6

Precipitation115 mm/mo 89.3–139

Air humidity61.7 % 60.3–65.0

Moisture balance38.8 mm/mo -21.7–92.2

Vapour deficit468 Pa 165–689

Wind speed4.50 m/s 1.80–6.20

Cloud cover51.8 % 48.0–63.4

CHELSA 1981–2010, ~9 km grid, at location & month of 230 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphitrite figulus

At a glance

Sources6 archives

Habitat & environment2

At a glance

Record type3 148 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 11 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 148 records