Amphitrite cirrata
Müller, 1776 · speciesAt a glance
Occurrence records3 306
Data sources7
Biological traits4
DNA specimens50
eDNA detections1 525
Sources7 archives
Databases and archives Amphitrite cirrata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 895 records↗
OBISOcean Biodiversity Information System1 411 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 525 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics50 specimens↗
Open Tree of LifeOpenTreephylogeny backbone↗
Catalogue of LifeCOLtaxonomy↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources4 traits
Occurrence & distributionGBIF · OBIS3 306 records
Environmental DNA12 datasets · 4 countries1 525 detections
DNA & barcodingBOLD50 specimens
01Narrative
Amphitrite cirrata is een borstelworm uit de familie Terebellidae. De wetenschappelijke naam van de soort werd in 1776 gepubliceerd door O.F. Müller.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesSeaLifeBase
Habitat & environment2
Habitat saltwateryes
Habitat zonesessile
Other traits2
Depth max984 m
Depth min4 m
05DNA & barcoding50 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphitrite cirrata has left across the world's sequence archives.
At a glance
DNA specimens50
BINs3
Marker genes3
eDNA detections1 525
Countries6
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P658 bp consensus44 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.
Where individuals differ — all 116 variable positions, in barcode order
7Tmostly conserved
13Tmostly conserved
22Gmostly conserved
25Tmostly conserved
34Cmostly conserved
43Cmostly conserved
58Cmostly conserved
64Tmostly conserved
68Amostly conserved
70Cmostly conserved
74Tmostly conserved
76Gmostly conserved
85Cmostly conserved
88Cmostly conserved
91Cmostly conserved
94Tmostly conserved
112Amostly conserved
139Tmostly conserved
142Amostly conserved
145Amostly conserved
151Cmostly conserved
163Tmostly conserved
169Cmostly conserved
172Cmostly conserved
175Cmostly conserved
178Cmostly conserved
184Amostly conserved
187Cmostly conserved
190Amostly conserved
193Cmostly conserved
199Tmostly conserved
212Tmostly conserved
217Amostly conserved
220Tmostly conserved
238Amostly conserved
263Cmostly conserved
265Cmostly conserved
268Cmostly conserved
277Amostly conserved
278Cmostly conserved
283Cmostly conserved
284Cmostly conserved
287Tmostly conserved
292Amostly conserved
295Amostly conserved
301Amostly conserved
304Amostly conserved
316Amostly conserved
318Cmostly conserved
319Amostly conserved
322Amostly conserved
325Amostly conserved
328Amostly conserved
331Amostly conserved
337Cmostly conserved
346Cmostly conserved
349Amostly conserved
352Tmostly conserved
355Amostly conserved
358Tmostly conserved
359Amostly conserved
364Tmostly conserved
367Cmostly conserved
370Cmostly conserved
373Amostly conserved
379Amostly conserved
388Tmostly conserved
391Cmostly conserved
394Cmostly conserved
397Cmostly conserved
400Tmostly conserved
401Tmostly conserved
403Amostly conserved
406Tmostly conserved
407Tmostly conserved
409Amostly conserved
412Cmostly conserved
418Cmostly conserved
421Amostly conserved
428Cmostly conserved
439Cmostly conserved
442Cmostly conserved
451Cmostly conserved
454Amostly conserved
460Tmostly conserved
469Cmostly conserved
472Amostly conserved
478Gmostly conserved
481Amostly conserved
484Cmostly conserved
500Cmostly conserved
523Cmostly conserved
533Tmostly conserved
535Amostly conserved
541Tmostly conserved
542Cmostly conserved
547Amostly conserved
553Cmostly conserved
562Amostly conserved
565Amostly conserved
568Tmostly conserved
574Tmostly conserved
577Gmostly conserved
589Tmostly conserved
592Amostly conserved
595Cmostly conserved
601Tmostly conserved
604Tmostly conserved
620Tmostly conserved
622Tmostly conserved
625Tmostly conserved
628Amostly conserved
643Tmostly conserved
646Cmostly conserved
652Tmostly conserved
655Amostly conserved
AACACTTTATTTTATTTTTGGGATTTGAGGAGGCCTTTTAGGCACCTCAATAAGACTCCTTATTCGAATCGAATTGGGCCAACCCGGCGC …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)5.5%
Haplotypes8
BINs3
Most divergent pair17.8%
N.AmericaEurope
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P18S-3P28S-D9-D10
animal barcoderibosomalmarker
08Occurrence & distribution
Record type3 306 records
Wild obs. + sensor635
Museum / vouchered2 139
Other532
Range
Area of Occupancy AOO3 500 km²
Depth
0–200 m sunlit899
200–1000 m twilight127
1–4 km midnight19
>4 km abyssal0
median 27.9 m · max 3 948.8 m · 1 045 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy99% within 1 km
≤100 m 476≤1 km 12≤10 km 2>10 km 3
493 georeferenced · 142 without coordinates
Open the mapobservation + sensor635
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy92% within 1 km
≤100 m 45≤1 km 216≤10 km 12>10 km 11
284 georeferenced · 1 855 without coordinates
Open the institutions mapphysical evidence2 139
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions14 of 47 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| NTNU-VMlocation not on record | 123 |
| CEFASlocation not on record | 62 |
| Bergen, NO | 49 |
| SLU Artdatabankenlocation not on record | 47 |
| Gothenburg, SE | 44 |
| Washington, US | 34 |
| Stockholm, SE | 29 |
| 730location not on record | 28 |
| University of Guelph, Centre for Biodiversity Genomicslocation not on record | 27 |
| Zoological Museum, Moscow Lomonosov State Universitylocation not on record | 27 |
| Bergen, NO | 26 |
| Norwegian Institute of Marine Researchlocation not on record | 26 |
| Maurice Lamontagne Institutelocation not on record | 14 |
| Institut Francais pour l'Etude de la Merlocation not on record | 14 |
| New Haven, US | 13 |
| MZLUlocation not on record | 12 |
| 486location not on record | 9 |
| Cambridge, US | 8 |
| Victoria, CA | 7 |
| The Atlantic reference Centrelocation not on record | 7 |
| Université de Liège Underwater research and oceanographic station (4501)location not on record | 5 |
| University Museum of Bergen, Natural History Collectionslocation not on record | 4 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 4 |
| South Kensington, GB | 3 |
| Tromsø, NO | 3 |
| DASSHlocation not on record | 3 |
| Instytut Oceanologii Polskiej Akademii Nauklocation not on record | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Laboratoria di biologia marina di Triestelocation not on record | 2 |
| CASlocation not on record | 2 |
| ARMS-MBONlocation not on record | 2 |
| Edmonton, CA | 2 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record | 2 |
| CoNISMalocation not on record | 1 |
| Frankfurt am Main | 1 |
| BioFokuslocation not on record | 1 |
| Copenhagen, DK | 1 |
| 630location not on record | 1 |
| NHMOlocation not on record | 1 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507)location not on record | 1 |
| Smithsonian Institution National Museum of Natural History, Department of Invertebrate Zoologylocation not on record | 1 |
| Natural History Museum, Londonlocation not on record | 1 |
| Helsinki, FI | 1 |
| Hellenic Centre for Marine Research-Institute of Marine Biology, Biotechnology and Aquaculturelocation not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393)location not on record | 1 |
| Christian-Albrechts-University Kiel; Leibniz Institute of Marine Sciences; Marine Ecology Division; Fishery Biology sectionlocation not on record | 1 |
| Santa Barbara Museum of Natural Historylocation not on record | 1 |
47 institutions · 656 of 2 139 vouchered records shown · 593 without an institution code
09Environmental DNA1 525 detections
Where the DNA of Amphitrite cirrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1 525
Studies independent surveys12
Countries4
Verifiable raw sequence linked1 169
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 525 detections have coordinates
Open the map4 countries0
Long-Term Ecological Research Site; LHI (Low…marineMarinePacific Ocean
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median8.80 °C -5.30–17.7
Seasonal swing summer↔winter23.5 °C
Max temp (day)10.2 °C -1.40–19.2
Min temp (night)5.80 °C -8.90–16.9
Precipitation101 mm/mo 46.5–150
Air humidity63.3 % 60.7–68.4
Moisture balance89.6 mm/mo
Vapour deficit415 Pa 158–677
Wind speed4.40 m/s
Cloud cover49.0 % 43.8–61.0
CHELSA 1981–2010, ~9 km grid, at location & month of 1 523 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.