Amphitornus coloradus

(Thomas, 1873) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Amphitornus

At a glance

Occurrence records1 512

Data sources8

Biological traits0

DNA specimens37

eDNA detections35

Sources8 archives

Databases and archives Amphitornus coloradus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 512 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 512 records

Environmental DNA1 datasets · 2 countries35 detections

DNA & barcodingBOLD37 specimens

01Narrative

Amphitornus coloradus, known generally as the striped slant-face grasshopper or striped grasshopper, is a species of slant-faced grasshopper in the family Acrididae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphitornus coloradus has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes1

eDNA detections35

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

1Tmostly conserved

7Cmostly conserved

10Tmostly conserved

20Gmostly conserved

235Cmostly conserved

310Tvariable

371Gmostly conserved

430Gmostly conserved

530Tmostly conserved

562Amostly conserved

586Cmostly conserved

613Cmostly conserved

625Amostly conserved

628Amostly conserved

634Tmostly conserved

643Tmostly conserved

653Tmostly conserved

TTTATACTTTATATTTGGAGCATGAGCTGGAATAGTAGGAACATCAATAAGAATACTTATTCGTGCAGAATTAGGACAACCAGGATCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes11

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Brachycrotaphus tryxalicerussame family8.7%Phaeocatantops sulphureussame family9.5%Stenohippus maculifemursame family9.5%Diabolocatantops pinguissame family9.8%Melanoplus differentialissame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 512 records

Wild obs. + sensor265

Museum / vouchered1 247

Range

Area of Occupancy AOO2 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 134≤1 km 44≤10 km 9>10 km 10

197 georeferenced · 68 without coordinates

Open the mapobservation + sensor265

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 10≤1 km 181≤10 km 482>10 km 258

931 georeferenced · 316 without coordinates

Open the institutions mapphysical evidence1 247

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad Católica de Manizaleslocation not on record	289
Colorado State Universitylocation not on record	207
University of Alabamalocation not on record	74
MISSA:MEMlocation not on record	43
US	43
Provo, US	40
Champaign, US	28
Wuzhou, CN	11
Albuquerque, US	8
CUlocation not on record	5
College Station, US	4
Mississippi State, US	4
Awka, NG	4
Royal Saskatchewan Museumlocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Natural History Museum of Los Angeles County, Entomology Sectionlocation not on record	1
WIlocation not on record	1
ASUlocation not on record	1
	1

19 institutions · 769 of 1 247 vouchered records shown · 478 without an institution code

09Environmental DNA35 detections

Where the DNA of Amphitornus coloradus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map2 countries0

Grassland4. Native Grassland | 4.4. Temperate Grassland1. Forest & Woodland | 1.4. Temperate Forest4. Grassland | 4.4. Grassland - Temperate

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 13.2–21.6

Seasonal swing summer↔winter25.1 °C

Max temp (day)27.0 °C 20.2–28.8

Min temp (night)13.2 °C 5.90–14.9

Precipitation36.0 mm/mo 23.3–84.0

Air humidity49.1 % 45.0–52.9

Moisture balance-123 mm/mo -155–-51.0

Vapour deficit1,161 Pa 747–1,295

Wind speed2.30 m/s 2.20–3.80

Cloud cover29.9 % 29.5–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphitornus coloradus

At a glance

Sources8 archives

At a glance

Record type1 512 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 512 records