Amphithrax aculeatus

(Herbst, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Mithracidae/Amphithrax

At a glance

Occurrence records198

Data sources8

Biological traits1

DNA specimens5

eDNA detections4

Sources8 archives

Databases and archives Amphithrax aculeatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility166 records↗

OBISOcean Biodiversity Information System32 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS198 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD5 specimens

01Narrative

Mithrax aculeatus is een krabbensoort uit de familie van de Mithracidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1790 door Herbst.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphithrax aculeatus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes3

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACACTATATTTTATATTTGGAGCTTGAGCTGGTATAGTAGGTACCTCTTTAAGATTAATTATTCGTGCCGAACTGGGGCAACCAGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mithrax tortugaesame family13.1%Mithrax hispidussame family13.1%Mithrax pleuracanthussame family13.4%Omalacantha bicornutasame family14.0%Gecarcoidea natalissame order14.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type198 records

Wild obs. + sensor49

Museum / vouchered148

Other1

Range

Area of Occupancy AOO464 km²

Depth

0–200 m sunlit11

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2 m · max 7 m · 11 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 7≤1 km 4≤10 km 4>10 km 10

25 georeferenced · 24 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 10≤10 km 5>10 km 1

16 georeferenced · 132 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	65
Paris, FR	28
Los Angeles, US	10
FCMMlocation not on record	8
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	6
Cambridge, US	4
Fundacion La Salle- Margarita- Venezuelalocation not on record	3
Universidad de Antioquia (UdeA)location not on record	2

8 institutions · 126 of 148 vouchered records shown · 4 without an institution code

09Environmental DNA4 detections

Where the DNA of Amphithrax aculeatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 20.7–25.0

Seasonal swing summer↔winter1.70 °C

Max temp (day)25.1 °C 24.7–27.2

Min temp (night)18.2 °C 17.6–23.1

Precipitation359 mm/mo 274–369

Air humidity71.2 % 67.0–72.3

Moisture balance219 mm/mo

Vapour deficit699 Pa 694–1,049

Wind speed1.70 m/s

Cloud cover33.8 % 31.9–38.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)