Amphitetranychus viennensis

(Zacher, 1920) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Trombidiformes/Tetranychidae/Amphitetranychus

At a glance

Occurrence records35

Data sources10

Biological traits0

DNA specimens68

eDNA detections66

Sources10 archives

Databases and archives Amphitetranychus viennensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI66 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF35 records

Environmental DNA1 datasets · 2 countries66 detections

DNA & barcodingBOLD68 specimens

Genome at a glanceTreeOfSex · GoaT · NCBI≈142 Mbp

01Narrative

Die Weißdornspinnmilbe (Tetranychus viennensis) gehört zur Familie der Spinnmilben (Tetranychidae). Diese Milbe ist als Pflanzenschädling bekannt. Sie befällt Kernobstgewächse, darunter den Eingriffeligen sowie den Zweigriffeligen Weißdorn.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphitetranychus viennensis has left across the world's sequence archives.

At a glance

DNA specimens68

BINs3

Marker genes4

eDNA detections66

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 76 variable positions, in barcode order

3Gmostly conserved

15Tmostly conserved

21Gmostly conserved

33Amostly conserved

39Tmostly conserved

42Cmostly conserved

52Amostly conserved

55Amostly conserved

75Tmostly conserved

81Amostly conserved

105Tmostly conserved

114Cmostly conserved

117Tmostly conserved

126Amostly conserved

127Gmostly conserved

135Amostly conserved

156Amostly conserved

168Tmostly conserved

180Amostly conserved

183Tmostly conserved

186Amostly conserved

213Tvariable

214Amostly conserved

218Tvariable

234Cmostly conserved

237Amostly conserved

243Cmostly conserved

251Gmostly conserved

255Cmostly conserved

294Gvariable

295Tmostly conserved

296Cmostly conserved

297Amostly conserved

298Amostly conserved

300Tmostly conserved

318Amostly conserved

336Tmostly conserved

339Tmostly conserved

342Amostly conserved

351Amostly conserved

369Tmostly conserved

396Tmostly conserved

411Tvariable

412Tmostly conserved

417Cvariable

424Gmostly conserved

425Cmostly conserved

444Tmostly conserved

447Tvariable

454Cvariable

457Tmostly conserved

459Amostly conserved

488Gvariable

490Avariable

502Tmostly conserved

504Tmostly conserved

505Cmostly conserved

513Tvariable

525Avariable

528Amostly conserved

540Amostly conserved

543Tmostly conserved

552Tmostly conserved

558Tvariable

561Tmostly conserved

564Cvariable

585Tmostly conserved

591Tmostly conserved

597Cvariable

600Avariable

606Tmostly conserved

612Tvariable

621Tmostly conserved

624Gvariable

630Tmostly conserved

633Tmostly conserved

ATGTATTTTATATTTAGTTTGTTTTCAGGTTTAATAGGTACCTCTTTTAGAATAATTATTCGTATAGAATTATTTCAACCAGGTTCTTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes4

BINs3

Most divergent pair7.4%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eotetranychus sexmaculatussame family13.4%Eotetranychus frostisame family13.7%Tetranychus truncatussame family14.4%Panonychus ulmisame family14.4%Panonychus citrisame family14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_032381 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1ND3ND4LCOX3ATP6ATP8COX2ND1CYTBND6ND4ND5ND216S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceTreeOfSex · GoaT · NCBI

The complete instruction manual Amphitetranychus viennensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈141 928 560 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Amphitetranychus viennensis0.14 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 6 n = 3

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 61×TreeOfSex · invert

TreeOfSex · invert — Oliver Jr, J. H. (1977). Cytogenetics of mites and ticks. Annual review of entomology, 22(1), 4 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type35 records

Wild obs. + sensor1

Museum / vouchered34

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 34 records without

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
CBGP – INRAlocation not on record	20
Ohio State University Acarology Laboratory, Columbus, OH (OSAL)location not on record	3
BSBRlocation not on record	1
Ilia State Universitylocation not on record	1

4 institutions · 25 of 34 vouchered records shown · 8 without an institution code

09Environmental DNA66 detections

Where the DNA of Amphitetranychus viennensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found66

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 66 detections have coordinates

Open the map2 countries0

Urban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 17.9–22.7

Seasonal swing summer↔winter26.9 °C

Max temp (day)23.1 °C 22.1–26.9

Min temp (night)13.4 °C 11.9–17.8

Precipitation96.5 mm/mo 90.4–164

Air humidity55.8 % 55.6–60.2

Moisture balance-33.6 mm/mo

Vapour deficit932 Pa 887–1,135

Wind speed2.40 m/s

Cloud cover42.1 % 29.4–45.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)