Amphisbatis incongruella

(Stainton, 1849) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lypusidae/Amphisbatis

At a glance

Occurrence records173

Data sources7

Biological traits2

DNA specimens11

eDNA detections2

Sources7 archives

Databases and archives Amphisbatis incongruella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF173 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD11 specimens

01Narrative

Amphisbatis is a monotypic genus of moths belonging to the family Oecophoridae. The only species is Amphisbatis incongruella. It is found in Europe. The wingspan is about 11 mm. The moth flies from March to May depending on the location. The larvae probably feed on Calluna and Thymus species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphisbatis incongruella has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections2

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

1Tmostly conserved

2Amostly conserved

3Cmostly conserved

4Amostly conserved

6Tmostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

13Tmostly conserved

14Amostly conserved

28Amostly conserved

181Avariable

217Cvariable

322Cmostly conserved

325Amostly conserved

500Cmostly conserved

550Cvariable

616Cmostly conserved

628Gmostly conserved

634Cmostly conserved

637Gmostly conserved

TACATTATATTTTATTTTAGGAATTTGAGCTGGAATAGTAGGTACATCTTTAAGATTAATAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes4

BIN1

Most divergent pair2.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Agnoea josephinaesame family8.7%Inga sparsiciliellasame order9.9%Psaliodes strigosasame order10.5%Heteroteucha distephanasame order10.6%Gonionota hypoleucasame order10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type173 records

Wild obs. + sensor129

Museum / vouchered43

Other1

Range

Area of Occupancy AOO460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 38≤1 km 40≤10 km 51

129 georeferenced

Open the mapobservation + sensor129

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 9≤1 km 12≤10 km 14

35 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	23
NHMOlocation not on record	8
Provincia di Livornolocation not on record	3
Tartu, EE	2
SLU Artdatabankenlocation not on record	2
South Kensington, GB	2
Natural History Museum, Londonlocation not on record	1

7 institutions · 41 of 43 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Amphisbatis incongruella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)