Amphipyra tetra

(Fabricius, 1787) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Amphipyra

At a glance

Occurrence records334

Data sources6

Biological traits0

DNA specimens14

eDNA detections8

Sources6 archives

Databases and archives Amphipyra tetra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility334 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF334 records

Environmental DNA1 datasets · 4 countries8 detections

DNA & barcodingBOLD14 specimens

01Narrative

Amphipyra tetra is een vlinder uit de familie uilen (Noctuidae). De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1787 door Fabricius. De soort komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphipyra tetra has left across the world's sequence archives.

At a glance

DNA specimens14

BINs5

Marker genes1

eDNA detections8

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 54 variable positions, in barcode order

43Amostly conserved

49Tmostly conserved

85Tmostly conserved

100Tmostly conserved

115Tmostly conserved

133Amostly conserved

184Amostly conserved

187Cvariable

202Tmostly conserved

206Cvariable

220Tmostly conserved

229Gmostly conserved

247Tvariable

286Avariable

292Cmostly conserved

319Amostly conserved

323Amostly conserved

364Amostly conserved

379Avariable

391Tvariable

394Tmostly conserved

403Amostly conserved

418Tmostly conserved

428Cmostly conserved

442Cmostly conserved

460Tmostly conserved

470Tmostly conserved

478Amostly conserved

479Tvariable

490Tvariable

511Amostly conserved

517Amostly conserved

520Amostly conserved

529Amostly conserved

562Tvariable

633Amostly conserved

634Tmostly conserved

635Cmostly conserved

637Amostly conserved

639Tmostly conserved

640Tvariable

641Tmostly conserved

643Amostly conserved

644Tmostly conserved

645Amostly conserved

646Cvariable

647Cmostly conserved

648Amostly conserved

650Cmostly conserved

651Amostly conserved

652Tmostly conserved

655Amostly conserved

656Tmostly conserved

658Cvariable

TACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes6

BINs5

Most divergent pair3.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Bryophila tephrocharissame family6.7%Mycteroplus puniceagosame family6.9%Amphipyra micanssame genus7.0%Scotogramma fieldisame family7.1%Nocloa pallenssame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type334 records

Wild obs. + sensor143

Museum / vouchered93

Other98

Origin

Native29

Range

Area of Occupancy AOO836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 39≤1 km 22≤10 km 50>10 km 3

114 georeferenced · 29 without coordinates

Open the mapobservation + sensor143

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 1≤1 km 23≤10 km 30>10 km 5

59 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence93

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	21
Provincia di Livornolocation not on record	20
SFRAlocation not on record	12
Zürich, CH	6
Tartu, EE	4
Geneva, CH	3
Sion, CH	3
European Distributed Institute of Taxonomy (EDIT)location not on record	2
Philadelphia, US	2
Naturmuseum St. Gallenlocation not on record	2
ZSMlocation not on record	1
Tiroler Landesmuseum Ferdinandeumlocation not on record	1
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	1

13 institutions · 78 of 93 vouchered records shown · 15 without an institution code

09Environmental DNA8 detections

Where the DNA of Amphipyra tetra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 11.2–20.8

Seasonal swing summer↔winter20.7 °C

Max temp (day)23.2 °C 15.1–25.5

Min temp (night)11.6 °C 4.60–15.4

Precipitation105 mm/mo 43.3–111

Air humidity57.0 % 54.1–60.0

Moisture balance-6.50 mm/mo -115–27.5

Vapour deficit938 Pa 547–1,077

Wind speed2.30 m/s 1.50–2.90

Cloud cover35.7 % 33.9–42.6

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)