Amphipyra monolitha

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Amphipyra

At a glance

Occurrence records337

Data sources6

Biological traits0

DNA specimens16

eDNA detections7

Sources6 archives

Databases and archives Amphipyra monolitha's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility337 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF337 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD16 specimens

01Narrative

Amphipyra monolitha is een vlinder uit de familie van de uilen (Noctuidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1852 door Guenée.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphipyra monolitha has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes1

eDNA detections7

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)2.2%

Haplotypes2

BINs2

Most divergent pair0.46%

Where individuals differ — all 32 variable positions, in barcode order

17Tmostly conserved

24Tmostly conserved

48Tvariable

87Gvariable

96Tmostly conserved

105Tmostly conserved

141Cvariable

177Cvariable

198Cvariable

213Avariable

231Tvariable

234Cvariable

237Tvariable

264Tvariable

282Cvariable

363Tvariable

366Cvariable

378Avariable

405Cvariable

417Tvariable

420Tvariable

438Cvariable

444Cvariable

462Tvariable

478Cvariable

499Cvariable

532Cvariable

546Tvariable

570Tvariable

573Tvariable

627Avariable

636Cvariable

ACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCTTTAAGACTATTAATTCGTGCTGAATTAGGAAATCCAGGGTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphipyra acheronsame genus4.5%Amphipyra surniasame genus4.6%Amphipyra pyramideasame genus5.8%Condica begallosame family7.5%Elaphria barbarossasame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type337 records

Wild obs. + sensor269

Museum / vouchered68

Range

Area of Occupancy AOO976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 3≤1 km 8>10 km 4

15 georeferenced · 254 without coordinates

Open the mapobservation + sensor269

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 21

21 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hiwa Museum of Natural Historylocation not on record	21
NSMKlocation not on record	20
Kawasaki Shi Tama Ku, JP	16
Taiwan Forestry Research Institutelocation not on record	4
Philadelphia, US	3
Chiba, JP	2
HUNMlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

8 institutions · 68 of 68 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Amphipyra monolitha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 19.2–19.2

Seasonal swing summer↔winter25.4 °C

Max temp (day)21.2 °C

Min temp (night)15.4 °C

Precipitation463 mm/mo

Air humidity65.7 %

Moisture balance325 mm/mo

Vapour deficit769 Pa

Wind speed2.50 m/s

Cloud cover50.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)