Amphipyra livida

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Amphipyra

At a glance

Occurrence records3 243

Data sources7

Biological traits0

DNA specimens23

eDNA detections23

Sources7 archives

Databases and archives Amphipyra livida's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 243 records

Environmental DNA1 datasets · 10 countries23 detections

DNA & barcodingBOLD23 specimens

01Narrative

Amphipyra livida is a moth in the family Noctuidae. It is found in central and southern Europe, although strays are known from further north. It is also known from Anatolia to Korea, China and Japan. The wingspan is 39–45 mm. Adults are mainly on wing from August to October. The larvae feed on various low-growing plants, such as Taraxacum and Hieracium species. Larvae can be found from April to July. The species overwinters as an egg.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphipyra livida has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections23

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

1Tmostly conserved

82Cmostly conserved

160Gvariable

169Cvariable

214Gvariable

238Tmostly conserved

340Cvariable

397Tmostly conserved

400Cvariable

412Ghighly variable

454Gvariable

514Cvariable

562Amostly conserved

646Tvariable

658Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes7

BIN1

Most divergent pair1.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Prometopus inassuetasame family5.6%Plagiomimicus triplagiatussame family6.1%Plagiomimicus mantisame family6.1%Plagiomimicus curiosumsame family6.1%Bryophila tephrocharissame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 243 records

Wild obs. + sensor1 988

Museum / vouchered955

Other300

Origin

Native112

Range

Area of Occupancy AOO5 680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 654≤1 km 161≤10 km 292>10 km 38

1 145 georeferenced · 843 without coordinates

Open the mapobservation + sensor1 988

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 450≤1 km 132≤10 km 151>10 km 13

746 georeferenced · 209 without coordinates

Open the institutions mapphysical evidence955

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	355
Muzeum Górnośląskie w Bytomiulocation not on record	136
Provincia di Livornolocation not on record	82
Hiwa Museum of Natural Historylocation not on record	72
Bern, CH	41
Tartu, EE	39
Zürich, CH	24
Kawasaki Shi Tama Ku, JP	16
SFRAlocation not on record	11
Uniwersytet Łódzkilocation not on record	11
Archäologie und Museum Baselland - Museum.BLlocation not on record	10
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	10
Musee d'Histoire Naturallelocation not on record	9
ИЗШ НАНУlocation not on record	6
Philadelphia, US	6
UMUlocation not on record	6
HUNMlocation not on record	5
Adam Mickiewicz University in Poznańlocation not on record	5
National Institute of Biological Resourceslocation not on record	4
Salzburg, AT	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Glarus, CH	4
ЗММУlocation not on record	2
Dhaka, BD	2
Tiroler Landesmuseum Ferdinandeumlocation not on record	2
DABUHlocation not on record	2
KNAMlocation not on record	1
МПХУlocation not on record	1
Hungarian Natural History Museumlocation not on record	1
Tallinn, EE	1
Chiba, JP	1
Gyeryonsan Natural History Museumlocation not on record	1
SLU Artdatabankenlocation not on record	1

33 institutions · 875 of 955 vouchered records shown · 80 without an institution code

09Environmental DNA23 detections

Where the DNA of Amphipyra livida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map10 countries0

Floodplain forestForest Edge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 11.0–20.6

Seasonal swing summer↔winter20.7 °C

Max temp (day)17.6 °C 13.7–25.1

Min temp (night)10.4 °C 7.00–15.8

Precipitation74.7 mm/mo 41.8–124

Air humidity61.6 % 56.1–63.5

Moisture balance-1.00 mm/mo -70.7–64.9

Vapour deficit611 Pa 488–1,062

Wind speed3.20 m/s 2.00–4.60

Cloud cover42.2 % 35.4–48.4

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphipyra livida

At a glance

Sources7 archives

At a glance

Record type3 243 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 243 records