Amphipyra effusa

Boisduval · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Amphipyra

At a glance

Occurrence records512

Data sources7

Biological traits0

DNA specimens12

eDNA detections15

Sources7 archives

Databases and archives Amphipyra effusa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility512 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF512 records

Environmental DNA1 datasets · 6 countries15 detections

DNA & barcodingBOLD12 specimens

01Narrative

Amphipyra effusa is a moth in the family Noctuidae. It is found from the Mediterranean region and Asia. The wingspan is 41–48 mm. The moth flies from May to September. The larvae feed on various plants, including Ferula, Populus, Erica, Cytisus and Cistus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphipyra effusa has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections15

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

3Cmostly conserved

40Gmostly conserved

100Gmostly conserved

316Amostly conserved

328Gmostly conserved

358Tmostly conserved

370Tmostly conserved

394Tmostly conserved

628Gmostly conserved

631Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTGGGAACTTCTCTAAGATTGTTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes4

BIN1

Most divergent pair1.1%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Leucogonia cosmopissame family8.7%Mamerthes terminalissame order8.8%Bleptina confusalissame order8.8%Ctenognophos grandinariasame order8.8%Stiria blanchardisame family8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type512 records

Wild obs. + sensor509

Museum / vouchered3

Origin

Native4

Range

Area of Occupancy AOO1 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 150≤1 km 95≤10 km 63>10 km 23

331 georeferenced · 178 without coordinates

Open the mapobservation + sensor509

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Tiroler Landesmuseum Ferdinandeumlocation not on record	1

1 institutions · 1 of 3 vouchered records shown · 2 without an institution code

09Environmental DNA15 detections

Where the DNA of Amphipyra effusa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map6 countries0

1. Forest & Woodland|1.4. Temperate Forest32

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 8.30–21.9

Seasonal swing summer↔winter16.6 °C

Max temp (day)15.7 °C 11.8–26.7

Min temp (night)9.00 °C 3.50–16.0

Precipitation91.5 mm/mo 56.8–147

Air humidity57.6 % 52.7–66.2

Moisture balance56.6 mm/mo

Vapour deficit607 Pa 393–1,235

Wind speed2.90 m/s

Cloud cover45.3 % 28.8–48.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)