Amphiodia urtica

(Lyman, 1860) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Ophiuroidea/Amphilepidida/Amphiuridae/Amphiodia

At a glance

Occurrence records593

Data sources6

Biological traits4

DNA specimens46

eDNA detections1

Sources6 archives

Databases and archives Amphiodia urtica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility593 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF593 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD46 specimens

01Narrative

Amphiodia urtica, commonly known as the burrowing brittle star or the long arm brittle star, is a species of brittle star belonging to the family Amphiuridae. It is found on the Pacific coast of North America at depths down to about 370 m.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max370 m

Depth min0 m

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphiodia urtica has left across the world's sequence archives.

At a glance

DNA specimens46

BINs1

Marker genes3

eDNA detections1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

88Avariable

208Avariable

223Tmostly conserved

292Avariable

436Amostly conserved

568Gmostly conserved

625Amostly conserved

AACTTTATACCTTATCTTTGGCGCATGAGCAGGTACCATTGGTACAGCTATGAGAAAAATTATCCGAGTAGAACTATCCCAACCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes12

BIN1

Most divergent pair2.1%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphiodia occidentalissame genus13.2%Amphioplus macraspissame family13.4%Amphipholis squamatasame family17.0%Ophiophragmus chilensissame family17.3%Ophiophragmus acutispinasame family17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S

animal barcoderibosomal

08Occurrence & distribution

Record type593 records

Wild obs. + sensor19

Museum / vouchered561

Other13

Range

Area of Occupancy AOO1 304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 5≤1 km 6≤10 km 2

13 georeferenced · 6 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 61≤1 km 4≤10 km 12>10 km 32

109 georeferenced · 452 without coordinates

Open the institutions mapphysical evidence561

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Los Angeles, US	275
CASlocation not on record	76
Victoria, CA	57
Instituto de Investigaciones Oceanológicas, Universidad Autónoma de Baja Californialocation not on record	40
Washington, US	35
Santa Barbara Museum of Natural Historylocation not on record	21
Cambridge, US	19
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	17
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	9
Natural History Museum of Los Angeles Countylocation not on record	2
Hakai Institutelocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Toronto, CA	1
Edmonton, CA	1
University of California San Diegolocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

16 institutions · 557 of 561 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Amphiodia urtica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Planktonic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 15.1–15.1

Seasonal swing summer↔winter15.7 °C

Max temp (day)20.5 °C

Min temp (night)11.6 °C

Precipitation87.3 mm/mo

Air humidity62.8 %

Moisture balance-6.00 mm/mo

Vapour deficit638 Pa

Wind speed3.40 m/s

Cloud cover42.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)