Amphinome rostrata

(Pallas, 1766) · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Amphinomida/Amphinomidae/Amphinome

At a glance

Occurrence records561

Data sources8

Biological traits2

DNA specimens8

eDNA detections13

Sources8 archives

Databases and archives Amphinome rostrata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility311 records↗

OBISOcean Biodiversity Information System250 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS561 records

Environmental DNA1 datasets · 4 countries13 detections

DNA & barcodingBOLD8 specimens

01Narrative

Amphinome rostrata is een borstelworm uit de familie Amphinomidae. Het lichaam van de worm bestaat uit een kop, een cilindrisch, gesegmenteerd lichaam en een staartstukje. De kop bestaat uit een prostomium en een peristomium en draagt gepaarde aanhangsels. Amphinome rostrata werd in 1867 voor het eerst wetenschappelijk beschreven door Kinberg.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphinome rostrata has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections13

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.74%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 14 variable positions, in barcode order

49Gmostly conserved

133Gvariable

166Amostly conserved

187Cmostly conserved

196Gmostly conserved

277Amostly conserved

280Tmostly conserved

313Gmostly conserved

437Tmostly conserved

466Avariable

535Tmostly conserved

553Amostly conserved

568Avariable

625Cmostly conserved

AACCATATACCTAATCTTCGGAATTTGAGCCGGGCTCCTAGGAACCTCGATGAGAATCCTCATTCGAACCGAACTAGGTCAACCCGGATC …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S-D9-D10

animal barcodemarker

08Occurrence & distribution

Record type561 records

Wild obs. + sensor123

Museum / vouchered437

Other1

Origin

Native1

Range

Area of Occupancy AOO800 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 14 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 44≤1 km 11≤10 km 4>10 km 5

64 georeferenced · 59 without coordinates

Open the mapobservation + sensor123

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 5≤1 km 16≤10 km 40>10 km 5

66 georeferenced · 371 without coordinates

Open the institutions mapphysical evidence437

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	141
Sydney, AU	34
Washington, US	16
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	8
Cambridge, US	6
Tapachula, MX	4
New Haven, US	3
University of Floridalocation not on record	3
Earth Sciences New Zealandlocation not on record	2
CASlocation not on record	2
Museum and Art Gallery of the Northern Territorylocation not on record	2
San Nicolás de los Garza, MX	2
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	1
CoNISMalocation not on record	1
Universidad del Magdalenalocation not on record	1
UM-RSMASlocation not on record	1
Stockholm, SE	1
Texas Cooperative Wildlife Collectionlocation not on record	1
Toronto, CA	1
Frankfurt am Main	1

20 institutions · 231 of 437 vouchered records shown · 5 without an institution code

09Environmental DNA13 detections

Where the DNA of Amphinome rostrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map4 countries0

fringing reef

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 20.1–27.3

Seasonal swing summer↔winter3.30 °C

Max temp (day)26.5 °C 22.7–28.1

Min temp (night)24.9 °C 18.1–26.3

Precipitation88.6 mm/mo 77.0–192

Air humidity63.2 % 60.8–71.8

Vapour deficit1,266 Pa 663–1,332

Cloud cover28.8 % 19.9–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)