Amphinemura wui

(Claassen, 1936) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Plecoptera/Nemouridae/Amphinemura

At a glance

Occurrence records395

Data sources8

Biological traits0

DNA specimens84

eDNA detections28

Sources8 archives

Databases and archives Amphinemura wui's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility395 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics84 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF395 records

Environmental DNA1 datasets · 1 countries28 detections

DNA & barcodingBOLD84 specimens

01Narrative

Amphinemura wui, the spiked forestfly, is a species of spring stonefly in the family Nemouridae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding84 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphinemura wui has left across the world's sequence archives.

At a glance

DNA specimens84

BINs3

Marker genes1

eDNA detections28

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus83 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

85Cmostly conserved

103Cmostly conserved

136Cvariable

178Cmostly conserved

181Amostly conserved

187Tmostly conserved

190Tmostly conserved

197Tmostly conserved

202Avariable

212Cmostly conserved

217Gmostly conserved

298Tmostly conserved

316Amostly conserved

331Amostly conserved

352Tmostly conserved

355Gvariable

415Gmostly conserved

466Amostly conserved

469Gmostly conserved

478Avariable

484Cmostly conserved

487Tmostly conserved

508Tmostly conserved

520Amostly conserved

526Tmostly conserved

562Amostly conserved

565Gvariable

598Avariable

628Amostly conserved

631Amostly conserved

634Cvariable

637Cmostly conserved

AACTCTTTACTTTATTTTCGGAGCTTGATCTGGAATAGTAGGGACATCTCTTAGTTTACTTATTCGAGCTGAATTAGGTCAACCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes24

BINs3

Most divergent pair14.4%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nemoura redimiculumsame family13.1%Soyedina carolinensissame family13.5%Zapada cinctipessame family13.6%Zapada columbianasame family14.1%Nemoura cercispinosasame family14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_059860 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type395 records

Wild obs. + sensor15

Museum / vouchered380

Range

Area of Occupancy AOO680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 15

15 georeferenced

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 113≤1 km 98≤10 km 62>10 km 2

275 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence380

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	218
Provo, US	49
West Virginia Universitylocation not on record	28
Washington, US	23
BYUClocation not on record	17
PNHClocation not on record	10
USNMENTlocation not on record	5
Western Kentucky Universitylocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
INHS Insect Collectionlocation not on record	1
Canadian National Collection Insectslocation not on record	1
Wuzhou, CN	1
Illinois Natural History Surveylocation not on record	1

13 institutions · 361 of 380 vouchered records shown · 19 without an institution code

09Environmental DNA28 detections

Where the DNA of Amphinemura wui was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 12.6–18.5

Seasonal swing summer↔winter19.5 °C

Max temp (day)20.9 °C 18.0–23.8

Min temp (night)11.0 °C 7.60–13.2

Precipitation136 mm/mo 115–148

Air humidity59.7 % 58.3–61.6

Moisture balance0.1 mm/mo -21.8–15.0

Vapour deficit700 Pa 613–885

Wind speed2.50 m/s 2.00–4.40

Cloud cover39.2 % 32.3–39.6

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)