Amphinemura sulcicollis

(Stephens, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Plecoptera/Nemouridae/Amphinemura

At a glance

Occurrence records23 237

Data sources9

Biological traits2

DNA specimens117

eDNA detections133

Sources9 archives

Databases and archives Amphinemura sulcicollis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 237 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI133 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics117 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF23 237 records

Environmental DNA4 datasets · 13 countries133 detections

DNA & barcodingBOLD117 specimens

Genome at a glanceGoaT · NCBI≈272 Mbp

01Narrative

Amphinemura sulcicollis is een steenvlieg uit de familie beeksteenvliegen (Nemouridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1836 door Stephens.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)saprophagous

05DNA & barcoding117 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphinemura sulcicollis has left across the world's sequence archives.

At a glance

DNA specimens117

BINs4

Marker genes3

eDNA detections133

Countries15

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P622 bp consensus85 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 117 variable positions, in barcode order

4Gmostly conserved

7Gmostly conserved

10Tmostly conserved

14Cmostly conserved

16Tmostly conserved

20Tmostly conserved

23Tmostly conserved

34Cmostly conserved

43Cmostly conserved

49Amostly conserved

64Amostly conserved

70Tmostly conserved

76Tmostly conserved

82Cmostly conserved

127Amostly conserved

130Amostly conserved

133Amostly conserved

148Gmostly conserved

151Tmostly conserved

157Cmostly conserved

161Cmostly conserved

169Cmostly conserved

175Gmostly conserved

178Tmostly conserved

181Gmostly conserved

184Amostly conserved

193Amostly conserved

196Tmostly conserved

199Cmostly conserved

202Cmostly conserved

211Tmostly conserved

226Gmostly conserved

229Tmostly conserved

235Tmostly conserved

238Cmostly conserved

241Amostly conserved

242Tmostly conserved

247Cmostly conserved

250Cmostly conserved

251Cmostly conserved

259Amostly conserved

262Cmostly conserved

265Cmostly conserved

271Gmostly conserved

280Gmostly conserved

289Amostly conserved

298Tmostly conserved

313Cmostly conserved

316Amostly conserved

319Tmostly conserved

322Tmostly conserved

325Tmostly conserved

328Cmostly conserved

331Cmostly conserved

334Cmostly conserved

337Gmostly conserved

340Amostly conserved

343Amostly conserved

346Tmostly conserved

358Cmostly conserved

361Tmostly conserved

364Tmostly conserved

365Cmostly conserved

367Tmostly conserved

379Amostly conserved

388Amostly conserved

391Tmostly conserved

400Tmostly conserved

403Tmostly conserved

415Cmostly conserved

421Tmostly conserved

424Cmostly conserved

433Gmostly conserved

436Amostly conserved

439Amostly conserved

442Amostly conserved

448Tmostly conserved

451Amostly conserved

454Cmostly conserved

457Tmostly conserved

463Cmostly conserved

466Amostly conserved

469Tmostly conserved

478Tmostly conserved

481Amostly conserved

490Amostly conserved

496Amostly conserved

499Tmostly conserved

500Cmostly conserved

502Cmostly conserved

503Cmostly conserved

505Amostly conserved

511Amostly conserved

512Tmostly conserved

514Amostly conserved

520Gmostly conserved

521Tmostly conserved

523Amostly conserved

526Amostly conserved

529Tmostly conserved

535Tmostly conserved

538Gmostly conserved

541Gmostly conserved

542Tmostly conserved

559Cmostly conserved

560Tmostly conserved

565Tmostly conserved

568Tmostly conserved

577Cmostly conserved

583Amostly conserved

586Cmostly conserved

589Gmostly conserved

601Amostly conserved

607Amostly conserved

616Cmostly conserved

617Cmostly conserved

622Tmostly conserved

AGTGGGGACTTCCCTTAGTTTATTAATTCGAGCCGAATTAGGCCAACCAGGCTCCTTAATTGGAGATGATCAAATTTATAACGTAATTGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.5%

Haplotypes23

BINs4

Most divergent pair17.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphinemura triangularissame genus12.4%Amphinemura megalobasame genus13.7%Amphinemura zonatasame genus14.3%Amphinemura borealissame genus14.3%Amphinemura clavilobasame genus14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amphinemura sulcicollis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈271 924 966 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amphinemura sulcicollis0.27 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness53% BUSCO

08Occurrence & distribution

Record type23 237 records

Wild obs. + sensor17 496

Museum / vouchered5 419

Other322

Origin

Native847

Range

Area of Occupancy AOO28 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 11 788≤1 km 257≤10 km 2 000>10 km 5

14 050 georeferenced · 3 446 without coordinates

Open the mapobservation + sensor17 496

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 2 649≤1 km 587≤10 km 1 837>10 km 15

5 088 georeferenced · 331 without coordinates

Open the institutions mapphysical evidence5 419

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	1 366
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	1 143
NTNU-VMlocation not on record	1 065
NHMOlocation not on record	394
Provincia di Livornolocation not on record	374
Institute of Biology of the University of Latvialocation not on record	71
Zürich, CH	57
Tromsø, NO	46
AQBGlocation not on record	26
CEAB-CSIClocation not on record	24
South Kensington, GB	22
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	22
Natural History Museum, Londonlocation not on record	21
Kuopio, FI	19
KNISlocation not on record	11
Universität Zürich, Naturhistorisches Museumlocation not on record	6
BioFokuslocation not on record	5
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Geneva, CH	4
ZSMlocation not on record	3
Musee cantonal de zoologie de Lausannelocation not on record	3
Champaign, US	3
Helsinki, FI	3
Ulster Museumlocation not on record	2
Dhaka, BD	2
CIBIOlocation not on record	1
Stockholm, SE	1
Uniwersytet Łódzkilocation not on record	1
Bonn, DE	1

29 institutions · 4 700 of 5 419 vouchered records shown · 719 without an institution code

09Environmental DNA133 detections

Where the DNA of Amphinemura sulcicollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found133

Studies independent surveys4

Countries13

Verifiable raw sequence linked59

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 133 detections have coordinates

Open the map13 countries0

puroStreamAlpine willow zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 7.70–14.1

Seasonal swing summer↔winter17.5 °C

Max temp (day)14.6 °C 10.4–17.9

Min temp (night)7.00 °C 4.20–9.20

Precipitation106 mm/mo 65.6–157

Air humidity62.3 % 58.3–69.0

Moisture balance12.3 mm/mo -43.6–91.3

Vapour deficit538 Pa 323–649

Wind speed3.70 m/s 1.90–5.40

Cloud cover48.1 % 41.1–58.7

CHELSA 1981–2010, ~9 km grid, at location & month of 131 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphinemura sulcicollis

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type23 237 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type23 237 records