Amphimallon majale

(Razoumowsky, 1789) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Amphimallon

At a glance

Occurrence records1 254

Data sources9

Biological traits0

DNA specimens18

eDNA detections14

Sources9 archives

Databases and archives Amphimallon majale's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 254 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 254 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD18 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

01Narrative

The European chafer (Amphimallon majale classified as Rhizotrogus majalis prior to Montreuil 2000) is a beetle of the family Scarabaeidae. Formerly found only in continental Europe, this invasive species is now found at temperate latitudes in North America. The large, white grubs of A. majale feed on the roots of most cool-latitude grasses, both wild and cultivated. This has made the European chafer an enemy of lawns.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphimallon majale has left across the world's sequence archives.

At a glance

DNA specimens18

BINs3

Marker genes1

eDNA detections14

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Diversity (π)2.8%

Haplotypes2

BINs3

Most divergent pair0.61%

Where individuals differ — all 93 variable positions, in barcode order

4Cmostly conserved

34Tmostly conserved

43Cmostly conserved

49Cmostly conserved

58Amostly conserved

67Amostly conserved

88Amostly conserved

103Cmostly conserved

106Cmostly conserved

115Cmostly conserved

250Tmostly conserved

271Cmostly conserved

278Tmostly conserved

286Tmostly conserved

287Cmostly conserved

304Gmostly conserved

334Tmostly conserved

337Tmostly conserved

340Cmostly conserved

343Amostly conserved

346Cmostly conserved

347Tmostly conserved

355Gmostly conserved

358Tmostly conserved

364Tmostly conserved

376Amostly conserved

391Tmostly conserved

401Cmostly conserved

403Cmostly conserved

415Amostly conserved

418Tmostly conserved

421Tmostly conserved

427Cmostly conserved

428Tmostly conserved

433Gvariable

442Cmostly conserved

457Amostly conserved

460Tmostly conserved

463Cmostly conserved

472Tmostly conserved

490Tmostly conserved

496Amostly conserved

500Cmostly conserved

521Tmostly conserved

542Cmostly conserved

547Cmostly conserved

548Cmostly conserved

550Cmostly conserved

553Amostly conserved

556Tmostly conserved

562Tmostly conserved

565Amostly conserved

574Tmostly conserved

580Cmostly conserved

592Tmostly conserved

595Tmostly conserved

601Tmostly conserved

608Tmostly conserved

611Tmostly conserved

614Gmostly conserved

615Amostly conserved

616Cmostly conserved

619Cmostly conserved

620Gmostly conserved

621Cmostly conserved

622Amostly conserved

623Gmostly conserved

625Amostly conserved

626Gmostly conserved

628Amostly conserved

629Gmostly conserved

631Amostly conserved

632Gmostly conserved

633Amostly conserved

634Tmostly conserved

635Cmostly conserved

637Tmostly conserved

638Amostly conserved

639Tmostly conserved

640Tmostly conserved

641Tmostly conserved

643Amostly conserved

644Tmostly conserved

645Amostly conserved

646Cmostly conserved

648Amostly conserved

650Cmostly conserved

651Amostly conserved

652Cmostly conserved

653Tmostly conserved

655Amostly conserved

656Tmostly conserved

658Tmostly conserved

TACCTTATATTTTTTATTTGGTAGATGAGCAGGTATAGTAGGCACCTCCTTAAGATTACTAATTCGAGCAGAACTAGGTAATCCAGGAAC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphimallon burmeisterisame genus5.5%Amphimallon ruficornesame genus5.6%Amphimallon assimilesame genus5.8%Amphimallon ochraceumsame genus10.1%Amphimallon solstitialesame genus10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Amphimallon majale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 205×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Dutrillaux AM, Dutrillaux B (2012) Chromosome analysis of 82 species of Scarabaeoidea (Coleoptera), with special focus on NOR localization. Cytogenet Genome Res 136: 208-219. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type1 254 records

Wild obs. + sensor1 087

Museum / vouchered167

Range

Area of Occupancy AOO3 592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 565≤1 km 110≤10 km 116>10 km 85

876 georeferenced · 211 without coordinates

Open the mapobservation + sensor1 087

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 3≤1 km 3≤10 km 62

68 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence167

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	71
SOVTlocation not on record	20
Toronto, CA	9
ASUlocation not on record	6
Lexington, US	6
Vitoria, ES	4
University Park, US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Cambridge, US	2
Biodiversity Institute of Ontariolocation not on record	2
University of Guelphlocation not on record	2
Paris, FR	1
Barcelona, ES	1
OSUClocation not on record	1
Saint John, CA	1

15 institutions · 131 of 167 vouchered records shown · 36 without an institution code

09Environmental DNA14 detections

Where the DNA of Amphimallon majale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

Steep deciduous woodWetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 13.1–20.6

Seasonal swing summer↔winter26.1 °C

Max temp (day)23.7 °C 17.1–25.9

Min temp (night)14.2 °C 8.50–16.1

Precipitation98.5 mm/mo 54.0–123

Air humidity57.3 % 55.6–62.8

Moisture balance-54.0 mm/mo -87.1–-1.80

Vapour deficit948 Pa 589–1,067

Wind speed2.60 m/s 2.50–3.60

Cloud cover45.3 % 38.7–52.3

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphimallon majale

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 254 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 254 records